The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	0	9671	2878505	transposase	Streptomyces_phage(100.0%)	6	NA	NA
AVG54098.1|41_1010_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AVG54099.1|1249_2569_+|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
AVG54100.1|2798_3743_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AVG54101.1|3742_4600_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AVG54102.1|4794_6024_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
AVG54103.1|6473_9671_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.5	4.2e-135
>prophage 2
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	28783	32916	2878505		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
AVG54122.1|28783_29527_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.4	1.7e-18
AVG54123.1|29606_30053_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AVG54124.1|30167_31325_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
AVG54125.1|31311_32916_+	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
>prophage 3
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	36685	39316	2878505	tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVG54130.1|36685_37960_+	PDZ domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
AVG54131.1|38053_39316_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
>prophage 4
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	45920	47627	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG54137.1|45920_47627_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 5
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	56367	61695	2878505		Mycobacterium_phage(50.0%)	3	NA	NA
AVG54147.1|56367_60192_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
AVG54148.1|60212_60809_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AVG54149.1|60837_61695_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
>prophage 6
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	65082	138724	2878505	protease,tRNA	Staphylococcus_phage(95.65%)	66	NA	NA
AVG54153.1|65082_65727_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVG54154.1|65741_66533_-	phosphotransferase	NA	NA	NA	NA	NA
AVG54155.1|67082_67931_-	D-amino-acid transaminase	NA	NA	NA	NA	NA
AVG54156.1|67934_69344_-	dipeptidase PepV	NA	NA	NA	NA	NA
AVG54157.1|69901_70324_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
AVG54158.1|70340_71036_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AVG54159.1|71032_72694_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AVG54160.1|81251_81563_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
AVG54161.1|81584_84002_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
AVG54162.1|84289_85471_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
AVG54163.1|85580_86534_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AVG54164.1|86530_87094_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
AVG54165.1|87216_87618_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVG54166.1|88187_89015_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVG54167.1|89017_89137_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54168.1|89248_90250_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
AVG54169.1|90371_90836_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
AVG54170.1|90848_92030_-	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
AVG54171.1|92040_92673_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
AVG56840.1|92679_93711_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
AVG54172.1|94203_95706_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
AVG54173.1|96228_96543_+	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
AVG54174.1|96542_97835_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
AVG54175.1|97921_98776_-	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	1.3e-38
AVG54176.1|99051_99276_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54177.1|99474_99945_+	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
AVG54178.1|100057_100501_+	competence protein ComK	NA	NA	NA	NA	NA
AVG54179.1|100487_100931_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
AVG54180.1|101226_101862_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG54181.1|102301_103015_-	transaldolase	NA	M1PR54	Cyanophage	35.3	9.4e-19
AVG54182.1|103274_103577_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54183.1|103832_104198_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AVG54184.1|104194_104548_+	camphor resistance protein CrcB	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
AVG54185.1|106544_107378_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
AVG54186.1|107589_108498_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
AVG54187.1|108619_109816_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
AVG54188.1|110187_111780_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
AVG56841.1|112157_112904_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
AVG54189.1|112908_113382_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
AVG54190.1|113447_113705_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AVG54191.1|113701_114703_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.3	5.3e-185
AVG54192.1|114707_116186_-	2-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
AVG56842.1|116344_116800_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
AVG54193.1|117102_117753_+	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	94.0	2.9e-51
AVG54194.1|117833_118829_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.9	2.6e-67
AVG54195.1|118903_119530_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.8	3.1e-74
AVG54196.1|119570_119912_+	DUF3969 domain-containing protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
AVG54197.1|120012_120585_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
AVG54198.1|122157_122259_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54199.1|123334_124564_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	6.8e-134
AVG54200.1|124556_126296_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
AVG54201.1|126276_126411_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54202.1|126473_127193_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	99.6	1.9e-131
AVG54203.1|127294_127402_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54204.1|127350_128070_-|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
AVG54205.1|128190_128910_-|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	98.7	1.3e-129
AVG54206.1|128967_129690_-|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
AVG54207.1|129814_130522_-|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
AVG54208.1|130957_131176_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54209.1|131484_132066_+	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.8	9.6e-54
AVG54210.1|132538_132757_-	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	80.6	2.0e-25
AVG54211.1|133012_133486_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54212.1|133490_134282_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AVG54213.1|134651_135635_-	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.4	1.8e-185
AVG54214.1|135636_136572_-	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
AVG54215.1|137935_138724_+	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	98.5	3.6e-144
>prophage 7
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	142773	147020	2878505		Staphylococcus_phage(66.67%)	6	NA	NA
AVG54221.1|142773_143529_-	exotoxin	NA	A0A075M4C7	Staphylococcus_phage	41.4	6.0e-40
AVG54222.1|143567_143963_-	enterotoxin	NA	A0A097PAT7	Streptococcus_pyogenes_phage	50.4	1.5e-26
AVG54223.1|143937_144339_-	enterotoxin	NA	A0A097PAT7	Streptococcus_pyogenes_phage	37.9	1.5e-10
AVG54224.1|144492_145221_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
AVG54225.1|145255_145975_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
AVG54226.1|146255_147020_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	37.1	2.3e-31
>prophage 8
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	154822	155563	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG54235.1|154822_155563_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 9
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	165193	165538	2878505		Streptococcus_phage(100.0%)	1	NA	NA
AVG54244.1|165193_165538_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 10
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	176135	176864	2878505		Planktothrix_phage(100.0%)	1	NA	NA
AVG54256.1|176135_176864_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 11
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	194929	196666	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG54264.1|194929_196666_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 12
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	212146	212776	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG54282.1|212146_212776_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 13
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	217830	218244	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG56846.1|217830_218244_-	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.3	6.7e-17
>prophage 14
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	221696	226725	2878505		Staphylococcus_phage(33.33%)	5	NA	NA
AVG54293.1|221696_222251_+	DNA polymerase III subunit epsilon	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
AVG54294.1|222318_223389_-	DNA polymerase IV	NA	NA	NA	NA	NA
AVG54295.1|223635_224166_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
AVG54296.1|224335_225697_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.6	1.4e-103
AVG54297.1|225777_226725_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
>prophage 15
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	233899	342840	2878505	holin,head,capsid,portal,protease,terminase,tail,coat,integrase	Staphylococcus_phage(83.51%)	138	312458:312478	343560:343580
AVG54304.1|233899_235903_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.2	1.2e-114
AVG54305.1|235906_238099_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
AVG54306.1|238095_238788_-	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
AVG54307.1|238959_239262_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54308.1|239370_240666_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
AVG54309.1|241525_242692_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
AVG54310.1|242722_243049_+	staphostatin A	NA	NA	NA	NA	NA
AVG54311.1|243340_243514_-	NETI motif-containing protein	NA	NA	NA	NA	NA
AVG54312.1|243494_244097_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
AVG54313.1|244367_245189_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
AVG54314.1|245181_246651_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.3	9.1e-109
AVG54315.1|246834_247911_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
AVG54316.1|247930_248725_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AVG54317.1|248796_248904_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54318.1|248914_250477_-	sodium-dependent dicarboxylate transporter SdcS	NA	NA	NA	NA	NA
AVG54319.1|250681_251779_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	3.3e-47
AVG54320.1|252147_252708_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
AVG54321.1|252760_253690_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AVG54322.1|253882_254056_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54323.1|254107_255487_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVG54324.1|255606_256635_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54325.1|256904_257306_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
AVG54326.1|257878_258052_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54327.1|258502_259543_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
AVG54328.1|259599_260442_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54329.1|260438_260996_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AVG54330.1|261055_261580_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54331.1|261700_262264_+	thioredoxin family protein	NA	NA	NA	NA	NA
AVG54332.1|262329_263070_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
AVG54333.1|263069_263942_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.0e-27
AVG54334.1|263938_264619_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
AVG54335.1|264619_265516_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
AVG54336.1|265512_265893_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVG54337.1|266150_266327_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54338.1|266569_266668_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54339.1|266867_268154_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVG54340.1|268432_268723_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AVG54341.1|268737_270168_-	protein map	NA	NA	NA	NA	NA
AVG54342.1|270513_270753_+	phospholipase	NA	A0A1P8L6A7	Staphylococcus_phage	100.0	2.0e-26
AVG54343.1|271124_271304_+	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	98.3	1.4e-24
AVG54344.1|271327_271636_+	hypothetical protein	NA	M9NTD8	Staphylococcus_phage	100.0	3.2e-40
AVG54345.1|271614_271875_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
AVG54346.1|271926_272277_-	inhibitor	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
AVG54347.1|272787_273084_-	peptidoglycan hydrolase	NA	A0A1P8L6B4	Staphylococcus_phage	95.9	1.6e-49
AVG54348.1|272990_273245_-	amidase	NA	Q4ZCK0	Staphylococcus_virus	93.0	8.0e-13
AVG54349.1|273171_273327_+	amidase	NA	NA	NA	NA	NA
AVG54350.1|273773_274265_-	staphylokinase	NA	A0A1W6JQ12	Staphylococcus_phage	99.4	4.7e-86
AVG54351.1|274479_275211_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	99.2	1.8e-145
AVG54352.1|275222_275477_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AVG54353.1|275528_275636_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56847.1|275688_275865_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
AVG54354.1|275973_276747_-	enterotoxin	NA	A0A1X9H080	Staphylococcus_phage	100.0	1.1e-145
AVG54355.1|277119_277494_-	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
AVG54356.1|277549_277837_-	hypothetical protein	NA	A0A1X9H0N7	Staphylococcus_phage	100.0	7.6e-44
AVG54357.1|277882_278035_-	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
AVG54358.1|278027_281810_-	hypothetical protein	NA	A0A1X9H096	Staphylococcus_phage	99.5	0.0e+00
AVG54359.1|281825_283310_-|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
AVG54360.1|283306_287836_-|tail	phage tail tape measure protein	tail	A0A1X9H084	Staphylococcus_phage	100.0	0.0e+00
AVG54361.1|288080_288431_-	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
AVG54362.1|288480_288705_-	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	98.6	8.8e-32
AVG54363.1|288746_289391_-|tail	phage tail protein	tail	W5R9H4	Staphylococcus_phage	100.0	6.5e-120
AVG54364.1|289391_289799_-	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
AVG54365.1|289795_290200_-	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	99.3	2.1e-68
AVG54366.1|290196_290559_-|head,tail	phage head-tail adapter protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
AVG54367.1|290542_290827_-|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
AVG54368.1|290816_291101_-	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
AVG54369.1|291120_292266_-|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
AVG54370.1|292289_293027_-|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
AVG54371.1|293010_294198_-|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
AVG54372.1|294213_295875_-|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
AVG54373.1|295871_296216_-	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AVG54374.1|296345_296645_-	HNH endonuclease	NA	G4KNP8	Staphylococcus_phage	100.0	4.6e-52
AVG54375.1|296876_297293_-	transcriptional regulator	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
AVG54376.1|297320_297521_-	hypothetical protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
AVG54377.1|297668_297875_-	DUF1381 domain-containing protein	NA	S4V684	Staphylococcus_phage	82.4	2.8e-24
AVG54378.1|297891_298065_-	hypothetical protein	NA	S4SVD5	Staphylococcus_phage	100.0	3.6e-25
AVG54379.1|298101_298635_-	dUTP pyrophosphatase	NA	A0A0H3U2T1	Staphylococcus_phage	100.0	1.6e-95
AVG54380.1|298627_298870_-	hypothetical protein	NA	A0A2I6PF40	Staphylococcus_phage	100.0	3.7e-36
AVG54381.1|298859_299096_-	DUF1024 domain-containing protein	NA	A0A0H3U313	Staphylococcus_phage	100.0	5.3e-35
AVG54382.1|299088_299460_-	acetyltransferase	NA	A0ZS31	Staphylococcus_virus	96.7	3.6e-62
AVG54383.1|299468_299711_-	hypothetical protein	NA	A0A0H3U4B0	Staphylococcus_phage	98.8	1.6e-39
AVG54384.1|299714_300083_-	hypothetical protein	NA	A0A0H3U2T3	Staphylococcus_phage	100.0	2.0e-49
AVG54385.1|300095_300500_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0H3U2W2	Staphylococcus_phage	100.0	1.4e-72
AVG54386.1|300508_300727_-	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	100.0	1.0e-37
AVG54387.1|300733_301627_-	DnaD domain protein	NA	A0A1P8L6F0	Staphylococcus_phage	100.0	3.2e-141
AVG54388.1|301656_302127_-	Single-stranded DNA-binding protein 1	NA	A0EWX3	Staphylococcus_phage	99.4	7.4e-81
AVG54389.1|302127_302745_-	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
AVG54390.1|302825_303746_-	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
AVG54391.1|303747_305691_-	ATPase	NA	A0A2I6PDH3	Staphylococcus_phage	98.0	0.0e+00
AVG54392.1|305699_305963_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
AVG54393.1|305971_306232_-	DUF1108 domain-containing protein	NA	A0A2I6PEM2	Staphylococcus_phage	93.0	1.2e-40
AVG54394.1|306236_306539_-	hypothetical protein	NA	A0A0F6N3N3	Staphylococcus_phage	62.0	8.0e-28
AVG54395.1|306628_306790_-	DUF1270 domain-containing protein	NA	C8CGY5	Staphylococcus_phage	88.7	2.0e-17
AVG54396.1|306786_307107_-	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
AVG54397.1|307161_307794_+	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
AVG54398.1|307808_307949_-	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
AVG54399.1|307979_308177_-	hypothetical protein	NA	A0A1W6JPV3	Staphylococcus_phage	100.0	1.2e-24
AVG54400.1|308192_308948_-	oxidoreductase	NA	A0A1P8L6G2	Staphylococcus_phage	100.0	3.3e-139
AVG54401.1|309004_309544_+	hypothetical protein	NA	A7TW92	Staphylococcus_phage	100.0	1.7e-97
AVG54402.1|309567_309828_-	transcriptional regulator	NA	A7TW91	Staphylococcus_phage	100.0	2.7e-40
AVG54403.1|309841_310084_-	transcriptional regulator	NA	Q9G038	Staphylococcus_virus	100.0	2.8e-39
AVG54404.1|310247_310964_+	helix-turn-helix domain-containing protein	NA	R9QTP6	Staphylococcus_phage	100.0	9.2e-131
AVG54405.1|310975_311833_+	restriction endonuclease	NA	R9QTP0	Staphylococcus_phage	99.6	3.5e-161
AVG54406.1|311877_312060_+	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
AVG54407.1|312159_312624_+	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
312458:312478	attL	AAAAAGTTGATTTAAATAATA	NA	NA	NA	NA
AVG54408.1|312682_313720_+|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
AVG54409.1|314838_315855_-	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.2	6.7e-26
AVG54410.1|315876_316932_-	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.6	7.4e-36
AVG54411.1|317367_318570_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AVG54412.1|318877_320185_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
AVG54413.1|321201_321924_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	34.9	2.1e-26
AVG54414.1|322092_322893_-	enterotoxin	NA	A0A097PAT7	Streptococcus_pyogenes_phage	47.5	6.1e-51
AVG54415.1|323679_324240_+	hypothetical protein	NA	Q4ZBG8	Staphylococcus_virus	68.1	5.4e-62
AVG54416.1|325118_325823_+	toxin	NA	NA	NA	NA	NA
AVG54417.1|325977_326547_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	97.4	7.9e-101
AVG54418.1|326543_326885_-	pathogenicity island protein	NA	A0A1W6JQM3	Staphylococcus_phage	99.1	1.4e-57
AVG54419.1|326887_327415_-|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
AVG54420.1|327465_327684_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54421.1|327701_328280_-	pathogenicity island protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.9	4.8e-29
AVG54422.1|328291_328633_-	pathogenicity island protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
AVG54423.1|329082_329724_-	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	87.8	2.3e-104
AVG54424.1|329720_330005_-	pathogenicity island protein	NA	A0A1W6JQE4	Staphylococcus_phage	100.0	1.2e-49
AVG54425.1|330006_330369_-	pathogenicity island protein	NA	A0A1W6JQD5	Staphylococcus_phage	98.3	5.8e-65
AVG54426.1|330654_332124_-	virulence-associated protein E	NA	A0A1W6JQD6	Staphylococcus_phage	99.6	3.4e-289
AVG54427.1|332140_333010_-	mobile element-associated protein	NA	A0A1W6JQL5	Staphylococcus_phage	96.9	3.2e-162
AVG54428.1|333076_333394_-	DUF1474 domain-containing protein	NA	Q4ZE75	Staphylococcus_phage	48.1	1.2e-18
AVG54429.1|333396_333606_-	pathogenicity island protein	NA	Q4ZE76	Staphylococcus_phage	92.8	2.2e-29
AVG54430.1|333598_333745_-	pathogenicity island protein	NA	NA	NA	NA	NA
AVG54431.1|333741_333969_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVG54432.1|334004_334211_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54433.1|334368_335016_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVG54434.1|335021_336128_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	44.2	5.9e-76
AVG54435.1|336690_337155_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	98.7	1.6e-80
AVG54436.1|337176_339549_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	4.3e-92
AVG54437.1|339582_340323_-	carboxylesterase	NA	NA	NA	NA	NA
AVG54438.1|340438_340672_-	protein-export membrane protein SecG	NA	NA	NA	NA	NA
AVG54439.1|340738_341197_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54440.1|341535_342840_-	enolase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
343560:343580	attR	TATTATTTAAATCAACTTTTT	NA	NA	NA	NA
>prophage 16
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	352179	358169	2878505	protease	Streptococcus_phage(40.0%)	5	NA	NA
AVG54448.1|352179_352767_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
AVG54449.1|353330_354275_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
AVG54450.1|354385_355381_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
AVG54451.1|355377_356289_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
AVG54452.1|357233_358169_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 17
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	362616	365463	2878505		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVG54457.1|362616_365463_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
>prophage 18
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	368781	369621	2878505		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG54461.1|368781_369621_-	peptidase M23	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 19
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	375699	381405	2878505		Streptococcus_phage(66.67%)	5	NA	NA
AVG54468.1|375699_376782_-	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	9.9e-44
AVG54469.1|377145_378012_-	DegV family protein	NA	NA	NA	NA	NA
AVG54470.1|378155_378797_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
AVG54471.1|378961_380017_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AVG54472.1|380334_381405_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 20
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	390684	414101	2878505		uncultured_Caudovirales_phage(35.71%)	23	NA	NA
AVG54483.1|390684_391446_-	iron ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
AVG54484.1|391442_392399_-	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
AVG56848.1|392385_393357_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
AVG54485.1|393395_393551_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54486.1|393731_394703_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AVG54487.1|394820_396926_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AVG54488.1|396888_397287_-	protein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AVG54489.1|397436_397703_-	ribonucleoside-diphosphate reductase	NA	NA	NA	NA	NA
AVG54490.1|398087_398954_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVG54491.1|398973_399474_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AVG54492.1|399503_399749_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54493.1|399814_401320_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AVG54494.1|401397_401499_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54495.1|401589_402507_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.1e-07
AVG54496.1|402775_402943_-	nitrogen fixation protein NifR	NA	NA	NA	NA	NA
AVG54497.1|403118_403217_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54498.1|403329_403872_-	5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AVG54499.1|404210_405269_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
AVG54500.1|405508_407023_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AVG54501.1|407015_407993_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	7.1e-25
AVG54502.1|408214_409996_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
AVG54503.1|410007_411891_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
AVG54504.1|412160_414101_-	lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 21
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	417240	427087	2878505		Pandoravirus(12.5%)	12	NA	NA
AVG54509.1|417240_418392_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.7	6.0e-23
AVG54510.1|418375_418969_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
AVG54511.1|419319_419988_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AVG54512.1|419989_420409_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AVG54513.1|420412_421126_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AVG54514.1|421224_421809_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54515.1|422088_422529_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54516.1|422871_423345_+	DoxX family protein	NA	NA	NA	NA	NA
AVG54517.1|423319_424006_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG54518.1|424005_425061_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
AVG54519.1|425132_426116_-	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	43.3	1.1e-62
AVG54520.1|426247_427087_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.5	9.6e-55
>prophage 22
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	438699	440073	2878505		Powai_lake_megavirus(100.0%)	1	NA	NA
AVG54532.1|438699_440073_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	33.6	2.3e-45
>prophage 23
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	445050	451330	2878505		Bacillus_phage(33.33%)	6	NA	NA
AVG54538.1|445050_446724_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.2	3.4e-11
AVG54539.1|446720_448352_-	cysteine ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.8	6.7e-12
AVG54540.1|448570_449446_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AVG54541.1|449617_450301_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54542.1|450303_450762_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
AVG54543.1|450763_451330_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	4.7e-21
>prophage 24
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	458120	458594	2878505		Pandoravirus(100.0%)	1	NA	NA
AVG54554.1|458120_458594_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 25
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	463856	464654	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG54558.1|463856_464654_+	peptidase M23	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 26
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	469483	470245	2878505		Planktothrix_phage(100.0%)	1	NA	NA
AVG54562.1|469483_470245_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 27
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	474619	475663	2878505		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AVG54569.1|474619_475663_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 28
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	482186	482984	2878505		Planktothrix_phage(100.0%)	1	NA	NA
AVG54577.1|482186_482984_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 29
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	486209	490168	2878505		Bacillus_phage(33.33%)	3	NA	NA
AVG54581.1|486209_487937_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
AVG54582.1|488357_489653_+	DUF1958 domain-containing protein	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
AVG54583.1|489769_490168_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 30
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	497102	497846	2878505		Indivirus(100.0%)	1	NA	NA
AVG54591.1|497102_497846_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 31
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	510384	510945	2878505		Streptococcus_phage(100.0%)	1	NA	NA
AVG54603.1|510384_510945_-	recombinase	NA	A0A141E172	Streptococcus_phage	35.1	5.7e-19
>prophage 32
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	523773	527127	2878505		Tupanvirus(50.0%)	3	NA	NA
AVG54615.1|523773_524784_-	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.6	1.9e-33
AVG56853.1|525282_525804_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54616.1|525831_527127_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 33
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	534699	536022	2878505		Erysipelothrix_phage(100.0%)	1	NA	NA
AVG54626.1|534699_536022_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	2.6e-107
>prophage 34
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	547326	547983	2878505		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
AVG54640.1|547326_547983_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 35
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	551624	554945	2878505		Staphylococcus_phage(50.0%)	3	NA	NA
AVG54646.1|551624_553001_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
AVG54647.1|553000_553294_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54648.1|553544_554945_-	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 36
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	578306	578969	2878505		Enterococcus_phage(100.0%)	1	NA	NA
AVG54666.1|578306_578969_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 37
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	585552	586740	2878505		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AVG54672.1|585552_586740_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 38
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	589768	600722	2878505		Streptococcus_phage(33.33%)	6	NA	NA
AVG54675.1|589768_591850_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
AVG54676.1|591972_592443_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVG54677.1|592508_592922_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVG54678.1|593019_593274_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
AVG56854.1|593410_597007_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
AVG54679.1|597170_600722_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.6	2.7e-50
>prophage 39
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	604405	609188	2878505	tRNA	Bacillus_virus(50.0%)	8	NA	NA
AVG54685.1|604405_604954_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
AVG54686.1|604966_605149_-	protein translocase subunit SecE	NA	NA	NA	NA	NA
AVG54687.1|605204_605348_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVG54688.1|605462_606032_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AVG54689.1|606112_606637_-	NYN domain-containing protein	NA	NA	NA	NA	NA
AVG54690.1|606636_607383_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AVG54691.1|607390_607795_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
AVG54692.1|607787_609188_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.8	1.2e-54
>prophage 40
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	615199	617656	2878505	protease	Escherichia_phage(100.0%)	1	NA	NA
AVG54697.1|615199_617656_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 41
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	631282	641553	2878505	tRNA	Catovirus(16.67%)	10	NA	NA
AVG54705.1|631282_632770_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
AVG54706.1|632822_632915_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54707.1|633308_633785_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVG54708.1|633781_634147_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AVG54709.1|634124_634928_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	3.0e-21
AVG54710.1|635143_636076_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
AVG54711.1|636254_637136_-	redox-regulated molecular chaperone Hsp33	NA	NA	NA	NA	NA
AVG54712.1|637363_639457_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
AVG54713.1|639713_640253_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
AVG54714.1|640257_641553_-|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	A0A1V0SI91	Klosneuvirus	24.5	4.8e-13
>prophage 42
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	650809	653274	2878505		Hokovirus(50.0%)	2	NA	NA
AVG54724.1|650809_651775_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
AVG54725.1|651921_653274_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 43
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	659221	662319	2878505	tRNA	Klosneuvirus(50.0%)	2	NA	NA
AVG54735.1|659221_661195_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.5e-93
AVG54736.1|661479_662319_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 44
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	666225	666843	2878505		Streptococcus_phage(100.0%)	1	NA	NA
AVG54743.1|666225_666843_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 45
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	675982	677680	2878505		Streptococcus_virus(100.0%)	1	NA	NA
AVG54748.1|675982_677680_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 46
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	694328	700366	2878505		Lactobacillus_phage(33.33%)	6	NA	NA
AVG54762.1|694328_695132_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	44.4	2.9e-16
AVG54763.1|695463_696306_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG54764.1|696342_697002_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG54765.1|697005_698031_-	methionine import ATP-binding protein MetN 1	NA	G9BWD6	Planktothrix_phage	37.3	3.7e-32
AVG54766.1|698325_699468_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AVG54767.1|699460_700366_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	3.8e-49
>prophage 47
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	726311	729072	2878505		Staphylococcus_phage(100.0%)	2	NA	NA
AVG54791.1|726311_727523_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.2	2.2e-44
AVG54792.1|727515_729072_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	99.0	9.8e-287
>prophage 48
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	740367	741743	2878505		Paenibacillus_phage(50.0%)	2	NA	NA
AVG54807.1|740367_740640_+	hypothetical protein	NA	A0A0C5AJ30	Paenibacillus_phage	50.6	1.3e-13
AVG54808.1|741038_741743_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	37.1	5.8e-29
>prophage 49
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	746674	771618	2878505	integrase	Streptococcus_phage(78.95%)	26	759769:759783	775697:775711
AVG54812.1|746674_748468_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	23.8	6.9e-26
AVG54813.1|748667_748982_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	77.7	1.2e-42
AVG54814.1|749002_749380_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	76.4	9.6e-47
AVG54815.1|749389_750163_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54816.1|750184_751588_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	66.5	2.2e-176
AVG54817.1|751769_752954_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	68.1	6.3e-161
AVG54818.1|752950_753241_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54819.1|753237_753459_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
AVG54820.1|753500_754280_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54821.1|754340_754841_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	63.0	1.7e-54
AVG54822.1|754896_755535_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56861.1|755606_756002_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.6	5.9e-47
AVG54823.1|755985_758439_+	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	78.9	0.0e+00
AVG54824.1|758435_760463_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	65.3	5.1e-195
759769:759783	attL	GTCAAATGATGAATC	NA	NA	NA	NA
AVG54825.1|760459_761482_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	2.4e-132
AVG56862.1|761489_762428_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.1e-83
AVG54826.1|762702_762789_+	tetracycline resistance protein	NA	NA	NA	NA	NA
AVG54827.1|762804_764724_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	97.2	0.0e+00
AVG54828.1|765066_765420_-	XRE family transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	89.7	2.2e-53
AVG54829.1|765651_765762_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54830.1|765890_766373_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	68.6	8.5e-48
AVG54831.1|766369_766600_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	1.0e-27
AVG54832.1|767097_767298_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
AVG54833.1|767324_768518_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.2	8.3e-44
AVG54834.1|768585_770127_-	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
AVG54835.1|770151_771618_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
775697:775711	attR	GTCAAATGATGAATC	NA	NA	NA	NA
>prophage 50
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	782098	783622	2878505		Enterococcus_phage(100.0%)	1	NA	NA
AVG54847.1|782098_783622_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.4e-40
>prophage 51
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	791936	798265	2878505		Staphylococcus_phage(50.0%)	10	NA	NA
AVG54858.1|791936_792440_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
AVG54859.1|792460_792757_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
AVG54860.1|792747_793017_+	hypothetical protein	NA	NA	NA	NA	NA
AVG54861.1|793000_793192_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	1.1e-22
AVG54862.1|793277_794375_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AVG54863.1|794386_794590_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
AVG54864.1|794619_795501_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AVG54865.1|795654_796500_-	chromosome partitioning protein ParB	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
AVG54866.1|796617_796956_-	hypothetical protein	NA	NA	NA	NA	NA
AVG54867.1|797161_798265_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 52
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	808203	809046	2878505		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVG54875.1|808203_809046_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	3.8e-11
>prophage 53
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	830353	833088	2878505		Bodo_saltans_virus(50.0%)	3	NA	NA
AVG54900.1|830353_831376_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
AVG54901.1|831353_832298_-	deacetylase SIR2	NA	NA	NA	NA	NA
AVG54902.1|832287_833088_-	hypothetical protein	NA	A0A2K9L8X2	Tupanvirus	43.4	5.8e-41
>prophage 54
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	851325	852003	2878505		Planktothrix_phage(100.0%)	1	NA	NA
AVG54920.1|851325_852003_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 55
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	867673	872113	2878505		Mycobacterium_phage(100.0%)	1	NA	NA
AVG54942.1|867673_872113_-	protein EssC	NA	V5UPA0	Mycobacterium_phage	25.6	6.3e-28
>prophage 56
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	882718	884380	2878505		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
AVG54952.1|882718_883378_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
AVG54953.1|883429_884380_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 57
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	893178	894615	2878505		Pandoravirus(100.0%)	1	NA	NA
AVG54964.1|893178_894615_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.1e-29
>prophage 58
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	898375	902914	2878505		Enterobacteria_phage(50.0%)	3	NA	NA
AVG54970.1|898375_900115_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
AVG54971.1|900374_901049_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
AVG54972.1|901192_902914_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 59
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	912241	913285	2878505		Synechococcus_phage(100.0%)	1	NA	NA
AVG54979.1|912241_913285_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	3.5e-14
>prophage 60
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	920498	922028	2878505		Vibrio_phage(100.0%)	1	NA	NA
AVG54987.1|920498_922028_+	PTS glucose transporter subunit IIB	NA	A0A2I7SAJ6	Vibrio_phage	50.7	4.5e-10
>prophage 61
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	930903	932409	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG54997.1|930903_932409_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 62
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	943516	948875	2878505		Tetraselmis_virus(50.0%)	3	NA	NA
AVG55006.1|943516_945766_-	formate acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
AVG55007.1|946353_947322_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG55008.1|947318_948875_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 63
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	959085	961145	2878505		Planktothrix_phage(50.0%)	2	NA	NA
AVG55017.1|959085_960183_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
AVG55018.1|960566_961145_-	M23 family peptidase	NA	A0A2K9VGT1	Pontimonas_phage	39.1	9.7e-14
>prophage 64
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	969694	972882	2878505		Planktothrix_phage(33.33%)	3	NA	NA
AVG55025.1|969694_971287_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	4.1e-22
AVG55026.1|971796_971994_-	transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	43.3	2.1e-05
AVG55027.1|972159_972882_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	4.1e-22
>prophage 65
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	976754	977435	2878505		Planktothrix_phage(100.0%)	1	NA	NA
AVG55032.1|976754_977435_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	2.9e-33
>prophage 66
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	994240	995425	2878505		Klosneuvirus(100.0%)	1	NA	NA
AVG55045.1|994240_995425_+	ornithine aminotransferase 1	NA	A0A1V0SKB7	Klosneuvirus	28.9	2.0e-34
>prophage 67
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1000261	1010545	2878505		Tupanvirus(50.0%)	3	NA	NA
AVG56870.1|1000261_1007437_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.7	4.5e-68
AVG55050.1|1007883_1009134_-	MFS transporter	NA	NA	NA	NA	NA
AVG56871.1|1009519_1010545_-	formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.5	8.5e-29
>prophage 68
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1014081	1017312	2878505		Bacillus_virus(50.0%)	4	NA	NA
AVG55055.1|1014081_1014822_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	2.5e-38
AVG55056.1|1015163_1015676_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
AVG55057.1|1015854_1016058_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55058.1|1016352_1017312_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 69
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1020653	1023138	2878505		Catovirus(50.0%)	2	NA	NA
AVG55062.1|1020653_1021799_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	25.9	4.6e-23
AVG55063.1|1021875_1023138_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	4.3e-22
>prophage 70
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1029973	1036538	2878505		Catovirus(50.0%)	6	NA	NA
AVG55071.1|1029973_1031098_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
AVG55072.1|1031101_1032211_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AVG55073.1|1032223_1033252_-	KR domain-containing protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
AVG55074.1|1033241_1035065_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	5.2e-29
AVG55075.1|1035084_1035849_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AVG55076.1|1035851_1036538_-	capsular biosynthesis protein	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 71
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1040558	1041734	2878505		Clostridium_phage(100.0%)	1	NA	NA
AVG55079.1|1040558_1041734_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.6	2.0e-29
>prophage 72
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1047173	1047947	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG55084.1|1047173_1047947_+	phosphonates import ATP-binding protein PhnC	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 73
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1055978	1056578	2878505		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVG55094.1|1055978_1056578_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 74
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1061515	1066611	2878505		Catovirus(50.0%)	7	NA	NA
AVG55099.1|1061515_1062496_-	NAD-dependent dehydratase	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
AVG55100.1|1062564_1062687_-	hypothetical protein	NA	NA	NA	NA	NA
AVG55101.1|1062830_1063607_-	diacetyl reductase ((S)-acetoin forming)	NA	NA	NA	NA	NA
AVG55102.1|1063818_1064445_-	MFS transporter	NA	NA	NA	NA	NA
AVG55103.1|1064511_1064703_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55104.1|1064640_1065405_-	siderophore biosynthesis protein SbnI	NA	NA	NA	NA	NA
AVG55105.1|1065408_1066611_-	siderophore biosynthesis PLP-dependent protein	NA	A0A2K9L4I2	Tupanvirus	21.1	3.9e-09
>prophage 75
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1074877	1079087	2878505		Lactococcus_phage(50.0%)	4	NA	NA
AVG55112.1|1074877_1075858_-	siderophore biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
AVG55113.1|1076088_1077081_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG55114.1|1077096_1078092_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AVG55115.1|1078088_1079087_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.8	5.2e-15
>prophage 76
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1112044	1113109	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG55137.1|1112044_1113109_-	dihydroneopterin aldolase	NA	A0A2H4PQR9	Staphylococcus_phage	42.5	7.7e-09
>prophage 77
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1123797	1125819	2878505		Streptococcus_phage(100.0%)	1	NA	NA
AVG55149.1|1123797_1125819_-	potassium-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	29.0	6.6e-41
>prophage 78
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1138233	1144565	2878505	transposase	Bacillus_phage(66.67%)	7	NA	NA
AVG55156.1|1138233_1139583_+	recombinase RecA	NA	Q9T200	Bacillus_phage	25.1	1.4e-18
AVG55157.1|1139604_1141233_+	recombinase RecB	NA	A0A0S2SXR4	Bacillus_phage	31.4	2.4e-46
AVG55158.1|1141750_1142101_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55159.1|1142187_1142499_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55160.1|1142516_1143023_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
AVG55161.1|1143043_1143361_+	DNA recombinase	NA	NA	NA	NA	NA
AVG55162.1|1143479_1144565_+|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
>prophage 79
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1147896	1148628	2878505		Streptococcus_phage(100.0%)	1	NA	NA
AVG55166.1|1147896_1148628_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 80
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1162134	1162809	2878505	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
AVG55181.1|1162134_1162809_+|transposase	IS6 family transposase IS431mec	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
>prophage 81
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1167192	1168155	2878505	transposase	Streptococcus_phage(50.0%)	2	NA	NA
AVG56878.1|1167192_1167390_+	replication family protein	NA	A0A286QS97	Streptococcus_phage	62.0	1.2e-08
AVG55186.1|1167480_1168155_+|transposase	IS6 family transposase IS431mec	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
>prophage 82
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1173810	1183820	2878505		Bacillus_phage(40.0%)	8	NA	NA
AVG55191.1|1173810_1174611_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
AVG55192.1|1174999_1175788_-	hypothetical protein	NA	NA	NA	NA	NA
AVG55193.1|1175788_1177123_-	hypothetical protein	NA	NA	NA	NA	NA
AVG55194.1|1177115_1178942_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
AVG55195.1|1178954_1179656_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
AVG55196.1|1180858_1182142_-	adenylosuccinate synthetase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
AVG55197.1|1182142_1182370_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55198.1|1182419_1183820_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 83
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1190511	1199557	2878505	tRNA	Bacillus_virus(50.0%)	6	NA	NA
AVG55205.1|1190511_1191798_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	4.5e-88
AVG55206.1|1191787_1191976_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55207.1|1192176_1193691_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.2e-90
AVG55208.1|1194016_1194829_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AVG55209.1|1194916_1197586_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	4.6e-119
AVG55210.1|1197622_1199557_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
>prophage 84
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1209657	1216214	2878505		Faecalibacterium_phage(25.0%)	9	NA	NA
AVG55219.1|1209657_1210497_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
AVG55220.1|1210665_1210848_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55221.1|1210947_1211301_+	DUF3147 domain-containing protein	NA	NA	NA	NA	NA
AVG55222.1|1211368_1211764_+	DUF3147 domain-containing protein	NA	NA	NA	NA	NA
AVG55223.1|1212023_1212593_+	XRE family transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
AVG55224.1|1212710_1212911_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
AVG55225.1|1213302_1213494_-	hypothetical protein	NA	NA	NA	NA	NA
AVG55226.1|1213585_1215466_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG55227.1|1215455_1216214_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 85
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1230466	1232179	2878505		Planktothrix_phage(100.0%)	1	NA	NA
AVG55241.1|1230466_1232179_+	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 86
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1237807	1238821	2878505		Faustovirus(100.0%)	1	NA	NA
AVG55248.1|1237807_1238821_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.9	9.6e-09
>prophage 87
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1251160	1251853	2878505		Streptococcus_phage(100.0%)	1	NA	NA
AVG55262.1|1251160_1251853_+	capsular biosynthesis protein	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 88
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1277951	1279811	2878505		Enterococcus_phage(100.0%)	1	NA	NA
AVG55281.1|1277951_1279811_-	CHAP domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 89
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1305494	1307245	2878505		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVG55301.1|1305494_1306382_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	2.5e-05
AVG55302.1|1306489_1307245_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 90
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1310665	1311163	2878505		Canarypox_virus(100.0%)	1	NA	NA
AVG55306.1|1310665_1311163_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 91
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1316157	1318541	2878505		Enterococcus_phage(100.0%)	2	NA	NA
AVG55312.1|1316157_1318008_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	9.3e-236
AVG55313.1|1318004_1318541_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.0	3.9e-41
>prophage 92
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1323419	1333533	2878505	holin	Klosneuvirus(50.0%)	9	NA	NA
AVG55320.1|1323419_1325129_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
AVG55321.1|1325406_1325619_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55322.1|1325898_1326342_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVG55323.1|1326535_1328134_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
AVG55324.1|1328193_1328523_-	hypothetical protein	NA	NA	NA	NA	NA
AVG55325.1|1328818_1330315_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
AVG55326.1|1330508_1331399_-	class I fructose-bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
AVG55327.1|1331521_1331938_-	hypothetical protein	NA	NA	NA	NA	NA
AVG55328.1|1332195_1333533_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.0e-18
>prophage 93
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1363866	1367656	2878505		Staphylococcus_phage(50.0%)	3	NA	NA
AVG55361.1|1363866_1364568_+	transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	5.2e-38
AVG55362.1|1364843_1365332_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVG55363.1|1365844_1367656_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 94
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1376090	1380332	2878505		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AVG55370.1|1376090_1377089_+	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	1.0e-34
AVG55371.1|1377179_1377386_-	copper resistance protein CopZ	NA	NA	NA	NA	NA
AVG55372.1|1377923_1380332_-	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	40.8	3.2e-127
>prophage 95
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1389573	1392609	2878505	protease	Enterobacteria_phage(50.0%)	2	NA	NA
AVG55381.1|1389573_1391679_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
AVG55382.1|1392087_1392609_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
>prophage 96
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1399035	1405419	2878505		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
AVG55389.1|1399035_1400775_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
AVG55390.1|1401075_1403142_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
AVG55391.1|1403521_1403932_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AVG55392.1|1403973_1404330_+	thioredoxin	NA	NA	NA	NA	NA
AVG55393.1|1404450_1405419_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	4.0e-12
>prophage 97
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1414708	1415701	2878505		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVG55405.1|1414708_1415701_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	3.7e-37
>prophage 98
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1424979	1425675	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG55414.1|1424979_1425675_-	lantibiotic ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	3.0e-38
>prophage 99
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1446071	1446938	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG55428.1|1446071_1446938_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	52.6	1.3e-78
>prophage 100
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1455123	1456932	2878505		Streptococcus_phage(100.0%)	1	NA	NA
AVG55437.1|1455123_1456932_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.3	3.9e-93
>prophage 101
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1468161	1468857	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG55451.1|1468161_1468857_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	35.6	4.3e-08
>prophage 102
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1473411	1474230	2878505		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
AVG55458.1|1473411_1474230_+	SDR family NAD(P)-dependent oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	27.2	1.3e-08
>prophage 103
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1482282	1483840	2878505		Planktothrix_phage(50.0%)	2	NA	NA
AVG55466.1|1482282_1483098_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	8.8e-13
AVG55467.1|1483090_1483840_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	9.0e-20
>prophage 104
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1491111	1495540	2878505		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
AVG55475.1|1491111_1491774_+	methionine ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.8	5.5e-21
AVG55476.1|1491766_1492543_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AVG55477.1|1492938_1494126_+	MFS transporter	NA	NA	NA	NA	NA
AVG55478.1|1494187_1495540_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 105
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1498934	1500793	2878505		Mycoplasma_phage(50.0%)	2	NA	NA
AVG55484.1|1498934_1500161_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
AVG55485.1|1500157_1500793_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 106
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1518521	1524783	2878505		Bacillus_phage(66.67%)	6	NA	NA
AVG55503.1|1518521_1519664_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
AVG55504.1|1519931_1520318_+	GtrA family protein	NA	NA	NA	NA	NA
AVG55505.1|1520451_1520559_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55506.1|1520585_1520696_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55507.1|1521261_1523025_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	2.5e-36
AVG55508.1|1523049_1524783_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 107
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1528244	1534015	2878505		Staphylococcus_phage(75.0%)	6	NA	NA
AVG55513.1|1528244_1529360_+	aminotransferase class V-fold PLP-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	1.6e-20
AVG55514.1|1529370_1530063_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
AVG55515.1|1530073_1530541_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55516.1|1530592_1531570_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
AVG55517.1|1531571_1532519_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	3.2e-139
AVG56893.1|1533085_1534015_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 108
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1541997	1542729	2878505		Bacillus_virus(100.0%)	1	NA	NA
AVG55528.1|1541997_1542729_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 109
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1559378	1560938	2878505		Escherichia_phage(100.0%)	1	NA	NA
AVG55544.1|1559378_1560938_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 110
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1583786	1584821	2878505		Bacillus_virus(100.0%)	1	NA	NA
AVG55569.1|1583786_1584821_+	thioredoxin reductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 111
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1594666	1598563	2878505		Hokovirus(33.33%)	4	NA	NA
AVG55577.1|1594666_1596040_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	2.3e-13
AVG55578.1|1596032_1596707_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
AVG55579.1|1596842_1597898_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AVG55580.1|1597897_1598563_+	hemin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
>prophage 112
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1602302	1603511	2878505		Salmonella_phage(100.0%)	1	NA	NA
AVG55585.1|1602302_1603511_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.3	3.9e-33
>prophage 113
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1615601	1616501	2878505		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVG55599.1|1615601_1616501_+	DUF4162 domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	2.1e-15
>prophage 114
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1623873	1624293	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG55608.1|1623873_1624293_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	61.9	2.6e-37
>prophage 115
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1629985	1630867	2878505		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVG55613.1|1629985_1630867_+	KR domain-containing protein	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	3.8e-62
>prophage 116
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1638745	1639381	2878505		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVG55621.1|1638745_1639381_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 117
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1652324	1656304	2878505		Staphylococcus_phage(50.0%)	4	NA	NA
AVG56899.1|1652324_1652963_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
AVG55634.1|1653273_1654398_+	hypothetical protein	NA	A0A2K9L3K5	Tupanvirus	22.8	9.3e-13
AVG55635.1|1654489_1655443_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	6.4e-31
AVG55636.1|1655803_1656304_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 118
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1660221	1661025	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG55641.1|1660221_1661025_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.3e-07
>prophage 119
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1680005	1680611	2878505		Pithovirus(100.0%)	1	NA	NA
AVG55662.1|1680005_1680611_+	molybdenum ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.1	4.3e-12
>prophage 120
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1692581	1695749	2878505		Leptospira_phage(100.0%)	1	NA	NA
AVG55679.1|1692581_1695749_+	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	21.8	1.1e-61
>prophage 121
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1719432	1721099	2878505		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVG55719.1|1719432_1720242_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.7e-19
AVG55720.1|1720238_1721099_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	9.7e-10
>prophage 122
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1729883	1737539	2878505		Enterobacteria_phage(33.33%)	7	NA	NA
AVG55731.1|1729883_1730900_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.7	1.0e-18
AVG55732.1|1731473_1731656_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55733.1|1732149_1733814_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	8.0e-45
AVG55734.1|1733850_1734555_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
AVG55735.1|1734938_1735364_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AVG55736.1|1735658_1736474_+	hydrolase	NA	NA	NA	NA	NA
AVG55737.1|1736684_1737539_+	M23 family peptidase	NA	E5G070	Clostridium_phage	37.9	4.9e-06
>prophage 123
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1740921	1743231	2878505		Staphylococcus_phage(50.0%)	4	NA	NA
AVG55740.1|1740921_1741770_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
AVG55741.1|1742002_1742206_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55742.1|1742292_1742454_-	hypothetical protein	NA	NA	NA	NA	NA
AVG55743.1|1742490_1743231_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 124
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1749551	1750964	2878505		Pandoravirus(100.0%)	1	NA	NA
AVG55751.1|1749551_1750964_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 125
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1754927	1756490	2878505		Vibrio_phage(100.0%)	1	NA	NA
AVG55755.1|1754927_1756490_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 126
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1766692	1767661	2878505		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG55766.1|1766692_1767661_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 127
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1783310	1784219	2878505		Klosneuvirus(100.0%)	1	NA	NA
AVG55775.1|1783310_1784219_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 128
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1787810	1795256	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG55779.1|1787810_1795256_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	31.5	3.9e-22
>prophage 129
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1801512	1804332	2878505		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AVG55784.1|1801512_1803318_+	glutamine--fructose-6-phosphate aminotransferase	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
AVG55785.1|1803549_1804332_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.3e-09
>prophage 130
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1815512	1819343	2878505		Clostridium_phage(50.0%)	5	NA	NA
AVG55799.1|1815512_1815956_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
AVG55800.1|1816076_1816787_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AVG55801.1|1817100_1817763_+	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
AVG55802.1|1817929_1818058_-	hypothetical protein	NA	NA	NA	NA	NA
AVG55803.1|1818041_1819343_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	3.6e-133
>prophage 131
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1827283	1828894	2878505		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AVG55812.1|1827283_1828894_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 132
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1836697	1844447	2878505		Bacillus_virus(25.0%)	9	NA	NA
AVG55820.1|1836697_1837297_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
AVG55821.1|1837297_1838374_+	peptide chain release factor 1	NA	NA	NA	NA	NA
AVG55822.1|1838360_1839197_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVG55823.1|1839229_1840327_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.3	2.3e-40
AVG55824.1|1840323_1840743_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AVG55825.1|1840849_1841374_+	TIGR01440 family protein	NA	NA	NA	NA	NA
AVG55826.1|1841400_1842639_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
AVG55827.1|1842666_1843296_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVG55828.1|1843319_1844447_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 133
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1854851	1855247	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG55843.1|1854851_1855247_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 134
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1861418	1862066	2878505		Moumouvirus(100.0%)	1	NA	NA
AVG55852.1|1861418_1862066_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 135
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1869266	1870787	2878505		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVG55860.1|1869266_1870787_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 136
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1877977	1880005	2878505		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVG55866.1|1877977_1880005_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	2.3e-25
>prophage 137
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1885154	1888538	2878505		Clostridium_botulinum_C_phage(50.0%)	6	NA	NA
AVG55874.1|1885154_1885517_+	mRNA interferase MazF	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
AVG55875.1|1885481_1885715_-	hypothetical protein	NA	NA	NA	NA	NA
AVG55876.1|1885865_1886867_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
AVG55877.1|1886985_1887312_+	anti-anti-sigma factor	NA	NA	NA	NA	NA
AVG55878.1|1887313_1887793_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
AVG55879.1|1887767_1888538_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.5	1.9e-20
>prophage 138
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1902656	1907380	2878505		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
AVG55887.1|1902656_1904186_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
AVG55888.1|1904215_1905220_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AVG55889.1|1905356_1905611_-	acetolactate synthase 1 regulatory subunit	NA	NA	NA	NA	NA
AVG55890.1|1905610_1907380_-	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.6	7.0e-63
>prophage 139
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1911140	1925204	2878505	tRNA	Moraxella_phage(16.67%)	12	NA	NA
AVG55895.1|1911140_1912166_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.6	3.4e-62
AVG55896.1|1912480_1914091_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	28.1	1.9e-19
AVG55897.1|1914179_1914308_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55898.1|1914452_1916381_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	30.2	9.3e-53
AVG55899.1|1916633_1917269_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AVG56907.1|1917623_1918652_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AVG55900.1|1918711_1918936_+	oxidoreductase	NA	NA	NA	NA	NA
AVG55901.1|1919143_1920394_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
AVG55902.1|1920576_1921527_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AVG55903.1|1921675_1923160_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	26.5	2.3e-19
AVG55904.1|1923156_1924116_+	carbohydrate kinase	NA	NA	NA	NA	NA
AVG55905.1|1924487_1925204_-	DNA-binding response regulator	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	33.5	1.4e-25
>prophage 140
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1932373	1946001	2878505	coat,protease,terminase,integrase	Staphylococcus_phage(66.67%)	20	1932410:1932425	1950586:1950601
AVG55914.1|1932373_1932658_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
1932410:1932425	attL	AAAAAAGAACAAGAAC	NA	NA	NA	NA
AVG55915.1|1932733_1934350_+	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
AVG55916.1|1934418_1935591_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	96.2	5.8e-215
AVG55917.1|1935604_1936279_-	XRE family transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
AVG55918.1|1936451_1936670_+	XRE family transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
AVG55919.1|1936674_1936992_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
AVG55920.1|1936988_1937135_+	pathogenicity island protein	NA	NA	NA	NA	NA
AVG55921.1|1937127_1937337_+	pathogenicity island protein	NA	Q4ZE76	Staphylococcus_phage	94.2	2.9e-29
AVG55922.1|1937339_1937666_+	DUF1474 domain-containing protein	NA	Q4ZE75	Staphylococcus_phage	89.8	1.5e-48
AVG55923.1|1937730_1938600_+	mobile element-associated protein	NA	Q4ZE74	Staphylococcus_phage	96.2	1.5e-164
AVG55924.1|1938613_1940323_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.8	1.4e-302
AVG55925.1|1940632_1941013_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
AVG55926.1|1941009_1941651_+	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	93.0	7.2e-111
AVG55927.1|1942100_1942442_+	pathogenicity island protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
AVG55928.1|1942453_1943032_+	pathogenicity island protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.9	4.8e-29
AVG55929.1|1943049_1943268_+	hypothetical protein	NA	NA	NA	NA	NA
AVG55930.1|1943318_1943846_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
AVG55931.1|1943848_1944190_+	pathogenicity island protein	NA	A0A1W6JQM3	Staphylococcus_phage	99.1	1.4e-57
AVG55932.1|1944186_1944756_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.9	9.3e-102
AVG55933.1|1945032_1946001_+|protease	CAAX protease	protease	A0A0H4U080	Erysipelothrix_phage	27.3	5.9e-24
1950586:1950601	attR	GTTCTTGTTCTTTTTT	NA	NA	NA	NA
>prophage 141
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1950526	1951255	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG55938.1|1950526_1951255_-	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	37.5	1.3e-18
>prophage 142
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1960407	1961651	2878505		Bacillus_phage(50.0%)	2	NA	NA
AVG55946.1|1960407_1961094_+	thermonuclease	NA	A0A1P8CWK6	Bacillus_phage	54.2	1.7e-33
AVG55947.1|1961450_1961651_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
>prophage 143
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1965051	1970229	2878505		Streptococcus_phage(50.0%)	8	NA	NA
AVG56909.1|1965051_1965612_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.4	3.8e-31
AVG55955.1|1965684_1966302_-	amino acid transporter	NA	NA	NA	NA	NA
AVG55956.1|1966456_1966951_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVG55957.1|1967349_1967772_-	organic hydroperoxide reductase OsmC/OhrA	NA	NA	NA	NA	NA
AVG55958.1|1967919_1968636_+	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	30.1	1.5e-16
AVG55959.1|1968718_1969258_+	nitroreductase	NA	NA	NA	NA	NA
AVG55960.1|1969408_1969729_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
AVG55961.1|1969872_1970229_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
>prophage 144
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1973545	1974571	2878505		Planktothrix_phage(100.0%)	1	NA	NA
AVG55968.1|1973545_1974571_+	methionine import ATP-binding protein MetN 2	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
>prophage 145
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	1978058	2026339	2878505	holin,head,portal,terminase,tail,integrase	Staphylococcus_phage(77.46%)	74	1982151:1982167	1991151:1991167
AVG55973.1|1978058_1978820_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
AVG55974.1|1978917_1980225_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AVG55975.1|1980339_1981581_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
AVG55976.1|1981570_1982035_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
1982151:1982167	attL	CGCCGTTGTAAATATAT	NA	NA	NA	NA
AVG55977.1|1982185_1983583_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVG55978.1|1983650_1984700_-|integrase	site-specific integrase	integrase	A1KWY3	Staphylococcus_virus	100.0	1.6e-203
AVG55979.1|1984811_1984991_+	excisionase	NA	A0EWN7	Staphylococcus_virus	100.0	8.3e-25
AVG55980.1|1984970_1985903_-	hypothetical protein	NA	A0EWN8	Staphylococcus_virus	100.0	3.9e-174
AVG55981.1|1985934_1986399_-	toxin	NA	A0A2I6PEK4	Staphylococcus_phage	94.1	3.6e-80
AVG55982.1|1986411_1986741_-	XRE family transcriptional regulator	NA	A0A2I6PEN2	Staphylococcus_phage	100.0	3.2e-54
AVG55983.1|1986901_1987093_+	XRE family transcriptional regulator	NA	A0A2I6PEL6	Staphylococcus_phage	100.0	2.3e-28
AVG55984.1|1987181_1987325_+	hypothetical protein	NA	W5R8I6	Staphylococcus_phage	100.0	2.5e-16
AVG55985.1|1987314_1987524_-	hypothetical protein	NA	W5R9J5	Staphylococcus_phage	100.0	1.2e-30
AVG55986.1|1987580_1988360_+	phage antirepressor	NA	M1RZB2	Staphylococcus_phage	92.6	4.1e-132
AVG55987.1|1988360_1988585_+	hypothetical protein	NA	A0A0F6N4M2	Staphylococcus_phage	100.0	3.2e-34
AVG55988.1|1988624_1988768_+	hypothetical protein	NA	W5R8I6	Staphylococcus_phage	100.0	2.5e-16
AVG55989.1|1988789_1989437_-	hypothetical protein	NA	S4V9K2	Staphylococcus_phage	100.0	2.0e-113
AVG55990.1|1989507_1989729_+	hypothetical protein	NA	E0Y3P2	Staphylococcus_virus	100.0	1.5e-31
AVG55991.1|1989721_1989883_+	DUF1270 domain-containing protein	NA	A0A0E3XBK7	Staphylococcus_phage	96.2	4.3e-20
AVG55992.1|1989975_1990278_+	hypothetical protein	NA	A0A0F6N3N3	Staphylococcus_phage	100.0	1.4e-48
AVG55993.1|1990282_1990543_+	DUF1108 domain-containing protein	NA	C8CGY6	Staphylococcus_phage	100.0	8.9e-44
AVG55994.1|1990552_1990774_+	DUF2483 domain-containing protein	NA	A7TWM6	Staphylococcus_phage	100.0	3.2e-34
AVG55995.1|1991390_1991816_+	Single-stranded DNA-binding protein 2	NA	B7T0A5	Staphylococcus_virus	88.7	2.1e-58
1991151:1991167	attR	ATATATTTACAACGGCG	NA	NA	NA	NA
AVG55996.1|1991826_1992378_+	HNH endonuclease	NA	A0A2H4PQR4	Staphylococcus_phage	98.9	5.1e-105
AVG55997.1|1992378_1993053_+	hypothetical protein	NA	R4IH15	Staphylococcus_phage	97.8	1.5e-127
AVG55998.1|1993192_1993474_-	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	100.0	2.6e-49
AVG55999.1|1993538_1994270_+	helix-turn-helix domain-containing protein	NA	A0A1J0MGB2	Staphylococcus_phage	78.8	9.8e-80
AVG56000.1|1994282_1995068_+	DNA replication protein DnaC	NA	A0A0H4J332	Staphylococcus_phage	100.0	1.9e-145
AVG56001.1|1995064_1995223_+	hypothetical protein	NA	A0A2I6PDX0	Staphylococcus_phage	94.2	1.1e-20
AVG56002.1|1995235_1995457_+	hypothetical protein	NA	A0A0H3U2V4	Staphylococcus_phage	100.0	2.2e-35
AVG56003.1|1995466_1995871_+	DUF1064 domain-containing protein	NA	A7TWN5	Staphylococcus_phage	100.0	7.1e-72
AVG56004.1|1995875_1996061_+	DUF3113 domain-containing protein	NA	W5R8N4	Staphylococcus_phage	100.0	1.4e-27
AVG56005.1|1996061_1996433_+	hypothetical protein	NA	A7TWN6	Staphylococcus_phage	95.9	4.0e-53
AVG56006.1|1996433_1996682_+	hypothetical protein	NA	S4V683	Staphylococcus_phage	97.6	8.8e-41
AVG56007.1|1996696_1996945_+	DUF1024 domain-containing protein	NA	A0A2H4PQK1	Staphylococcus_phage	93.9	1.7e-36
AVG56008.1|1996937_1997474_+	dUTPase	NA	A0A1P8L6E0	Staphylococcus_phage	100.0	2.1e-95
AVG56009.1|1997510_1997717_+	DUF1381 domain-containing protein	NA	A0A1W6JPM8	Staphylococcus_phage	100.0	4.9e-21
AVG56010.1|1997713_1997908_+	hypothetical protein	NA	S4SX95	Staphylococcus_phage	100.0	7.9e-29
AVG56011.1|1997904_1998108_+	hypothetical protein	NA	A0A0N9BAX5	Staphylococcus_phage	100.0	5.2e-31
AVG56012.1|1998100_1998337_+	hypothetical protein	NA	S4SWB7	Staphylococcus_phage	100.0	1.6e-36
AVG56013.1|1998320_1998713_+	hypothetical protein	NA	A0A2I6PDC1	Staphylococcus_phage	99.2	1.8e-64
AVG56014.1|1998712_1998886_+	transcriptional regulator	NA	S4SVE4	Staphylococcus_phage	98.2	1.1e-21
AVG56015.1|1998886_1999033_+	hypothetical protein	NA	Q4ZDN7	Staphylococcus_virus	100.0	1.3e-15
AVG56016.1|1999047_1999467_+	transcriptional regulator	NA	I1W651	Staphylococcus_phage	100.0	8.1e-71
AVG56017.1|1999653_2000094_+|terminase	terminase small subunit	terminase	I1W650	Staphylococcus_phage	99.3	2.4e-73
AVG56018.1|2000080_2001358_+|terminase	PBSX family phage terminase large subunit	terminase	A0EWS5	Staphylococcus_virus	99.8	5.1e-249
AVG56019.1|2001368_2002904_+|portal	phage portal protein	portal	Q4ZDV9	Staphylococcus_virus	99.4	9.3e-290
AVG56020.1|2002910_2003906_+|head	phage head morphogenesis protein	head	E0Y3K7	Staphylococcus_virus	100.0	3.4e-184
AVG56021.1|2003978_2004149_+	hypothetical protein	NA	Q4ZDF2	Staphylococcus_virus	100.0	3.3e-23
AVG56022.1|2004283_2004898_+	DUF4355 domain-containing protein	NA	A0EWS9	Staphylococcus_virus	100.0	4.9e-40
AVG56023.1|2005906_2006194_+	hypothetical protein	NA	S4V6D9	Staphylococcus_phage	100.0	4.7e-46
AVG56024.1|2006202_2006535_+|head,tail	phage head-tail adapter protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
AVG56025.1|2006531_2006834_+	hypothetical protein	NA	S4V7K8	Staphylococcus_phage	100.0	1.1e-50
AVG56026.1|2006833_2007181_+	hypothetical protein	NA	S4V987	Staphylococcus_phage	100.0	3.1e-60
AVG56027.1|2007192_2007576_+	hypothetical protein	NA	A0A0F6N3L1	Staphylococcus_phage	100.0	1.5e-68
AVG56028.1|2007594_2008176_+|tail	phage major tail protein, TP901-1 family	tail	A0A0F6N3L8	Staphylococcus_phage	100.0	4.9e-106
AVG56029.1|2008237_2008603_+|tail	phage tail protein	tail	S4V9M6	Staphylococcus_phage	100.0	2.8e-59
AVG56030.1|2008632_2008977_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
AVG56031.1|2008993_2012458_+	hypothetical protein	NA	S4V989	Staphylococcus_phage	100.0	5.8e-271
AVG56032.1|2012470_2013418_+|tail	phage tail family protein	tail	S4V688	Staphylococcus_phage	100.0	3.6e-183
AVG56033.1|2013426_2015328_+	peptidase	NA	Q4ZDD8	Staphylococcus_virus	100.0	0.0e+00
AVG56034.1|2015342_2017253_+	hypothetical protein	NA	A1KX41	Staphylococcus_virus	99.8	0.0e+00
AVG56035.1|2017252_2019076_+	DUF2479 domain-containing protein	NA	W5R8J5	Staphylococcus_phage	99.2	7.4e-294
AVG56036.1|2019075_2019453_+	DUF2977 domain-containing protein	NA	Q9FZY7	Staphylococcus_virus	99.2	3.4e-60
AVG56037.1|2019456_2019630_+	XkdX family protein	NA	A0A0F6N3L7	Staphylococcus_phage	100.0	6.6e-27
AVG56038.1|2019670_2019970_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
AVG56039.1|2020106_2022005_+	CHAP domain-containing protein	NA	Q8SDT1	Staphylococcus_phage	99.8	0.0e+00
AVG56040.1|2022017_2023256_+	DUF2479 domain-containing protein	NA	A0A0F6N3G7	Staphylococcus_phage	98.1	2.7e-207
AVG56041.1|2023261_2023657_+	hypothetical protein	NA	A0A0E3XBL9	Staphylococcus_phage	97.7	1.4e-67
AVG56042.1|2023712_2024150_+|holin	phage holin	holin	Q8SDS8	Staphylococcus_phage	99.3	6.9e-73
AVG56043.1|2024130_2025576_+	CHAP domain-containing protein	NA	Q08JW9	Staphylococcus_phage	99.8	1.8e-295
AVG56044.1|2025818_2025971_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
AVG56045.1|2026041_2026152_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	97.2	4.9e-12
AVG56046.1|2026138_2026339_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
>prophage 146
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2040874	2043543	2878505		Tupanvirus(50.0%)	2	NA	NA
AVG56066.1|2040874_2042332_+	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	28.5	2.6e-39
AVG56067.1|2042328_2043543_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
>prophage 147
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2047586	2051214	2878505		Lake_Baikal_phage(50.0%)	3	NA	NA
AVG56074.1|2047586_2047946_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.7e-14
AVG56075.1|2048399_2049608_+	NADH dehydrogenase	NA	NA	NA	NA	NA
AVG56076.1|2049738_2051214_+	aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	4.5e-47
>prophage 148
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2061134	2068126	2878505		Aureococcus_anophage(33.33%)	6	NA	NA
AVG56087.1|2061134_2061728_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
AVG56088.1|2062142_2062520_+	general stress protein	NA	NA	NA	NA	NA
AVG56089.1|2062881_2064009_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
AVG56090.1|2064316_2065507_+	Ornithine aminotransferase 2	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
AVG56091.1|2065615_2066860_+	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
AVG56092.1|2067196_2068126_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
>prophage 149
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2078280	2081934	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG56100.1|2078280_2081934_+	ATP-dependent helicase/nuclease subunit A	NA	A7KV33	Bacillus_phage	24.5	2.0e-24
>prophage 150
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2087053	2093863	2878505		Pseudomonas_phage(33.33%)	4	NA	NA
AVG56106.1|2087053_2088868_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	6.7e-37
AVG56107.1|2089070_2091680_+	chaperone protein ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
AVG56108.1|2091738_2092608_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG56109.1|2092717_2093863_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
>prophage 151
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2102454	2104468	2878505		Planktothrix_phage(50.0%)	2	NA	NA
AVG56120.1|2102454_2103537_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
AVG56121.1|2103526_2104468_+	peptide ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
>prophage 152
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2108119	2165102	2878505	holin,protease,tRNA,bacteriocin	Bacillus_virus(22.22%)	59	NA	NA
AVG56124.1|2108119_2109106_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	1.4e-15
AVG56125.1|2109108_2110089_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.3e-15
AVG56126.1|2110081_2111044_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG56127.1|2111055_2111937_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG56128.1|2111978_2112968_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVG56129.1|2113261_2113657_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AVG56130.1|2114027_2114747_+	adaptor protein MecA	NA	NA	NA	NA	NA
AVG56131.1|2114867_2115854_+	competence protein CoiA	NA	NA	NA	NA	NA
AVG56132.1|2115901_2117710_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
AVG56133.1|2118169_2118976_-	DsbA family protein	NA	NA	NA	NA	NA
AVG56134.1|2118998_2119364_-	globin	NA	NA	NA	NA	NA
AVG56135.1|2119467_2120061_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AVG56136.1|2120246_2120594_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56137.1|2120610_2121246_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AVG56138.1|2121262_2122072_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVG56139.1|2122068_2122923_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AVG56140.1|2122943_2124329_+	magnesium transporter	NA	NA	NA	NA	NA
AVG56141.1|2124338_2126183_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVG56142.1|2126460_2127231_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVG56143.1|2127427_2128513_-	AI-2E family transporter	NA	NA	NA	NA	NA
AVG56144.1|2128854_2130423_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AVG56145.1|2130567_2131326_+	esterase family protein	NA	NA	NA	NA	NA
AVG56146.1|2131519_2132029_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56147.1|2132141_2133350_-	MFS transporter	NA	NA	NA	NA	NA
AVG56148.1|2133309_2134485_-	diacylglycerol beta-glucosyltransferase	NA	NA	NA	NA	NA
AVG56149.1|2134917_2136402_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AVG56150.1|2136382_2136643_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56151.1|2136642_2138205_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
AVG56152.1|2138506_2139310_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AVG56153.1|2139528_2141853_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	27.4	2.8e-11
AVG56154.1|2141869_2143228_+	Ktr system potassium uptake protein D	NA	NA	NA	NA	NA
AVG56155.1|2143366_2144878_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AVG56156.1|2145364_2145934_-	competence protein ComK	NA	NA	NA	NA	NA
AVG56157.1|2146143_2146362_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AVG56158.1|2146442_2147429_-	lipoate--protein ligase	NA	NA	NA	NA	NA
AVG56159.1|2147627_2147804_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AVG56160.1|2147818_2148421_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG56911.1|2148720_2148798_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AVG56161.1|2149336_2149438_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56912.1|2149447_2149720_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AVG56162.1|2149763_2151728_+	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
AVG56163.1|2151730_2152051_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56164.1|2152047_2152689_+|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	33.0	1.7e-19
AVG56165.1|2152776_2153067_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56166.1|2153207_2153345_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AVG56167.1|2153433_2153790_-	DoxX family protein	NA	NA	NA	NA	NA
AVG56168.1|2154277_2155237_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG56169.1|2155282_2155414_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56170.1|2155477_2155768_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
AVG56171.1|2155857_2156409_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVG56172.1|2156460_2157399_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVG56173.1|2157549_2157654_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56174.1|2157730_2158942_+	isochorismate synthase	NA	NA	NA	NA	NA
AVG56175.1|2158928_2160602_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVG56176.1|2160588_2161392_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVG56177.1|2161384_2162206_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AVG56178.1|2162443_2162773_-	staphostatin B	NA	NA	NA	NA	NA
AVG56179.1|2162810_2163992_-|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
AVG56180.1|2164073_2165102_-|protease	serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	32.3	6.3e-16
>prophage 153
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2168768	2172515	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG56185.1|2168768_2172515_-	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 154
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2182969	2197732	2878505		Synechococcus_phage(22.22%)	14	NA	NA
AVG56195.1|2182969_2183830_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	38.8	4.4e-39
AVG56196.1|2184030_2184513_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
AVG56197.1|2184499_2185624_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVG56198.1|2185627_2186332_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
AVG56199.1|2186331_2186595_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVG56200.1|2186596_2187268_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVG56201.1|2187260_2189450_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
AVG56202.1|2189428_2190913_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
AVG56203.1|2190905_2191934_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
AVG56204.1|2191936_2192503_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
AVG56205.1|2192517_2193996_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
AVG56206.1|2194017_2195265_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AVG56207.1|2195532_2196339_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AVG56208.1|2196331_2197732_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
>prophage 155
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2201163	2205543	2878505		Streptococcus_phage(50.0%)	5	NA	NA
AVG56212.1|2201163_2202336_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
AVG56213.1|2202389_2202932_+	DUF697 domain-containing protein	NA	NA	NA	NA	NA
AVG56214.1|2203085_2203352_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVG56215.1|2203354_2205073_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AVG56216.1|2205309_2205543_-	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
>prophage 156
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2211555	2220388	2878505		Synechococcus_phage(25.0%)	9	NA	NA
AVG56223.1|2211555_2212107_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.0	1.6e-13
AVG56224.1|2212471_2213098_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56225.1|2213268_2214381_+	pyruvate dehydrogenase E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
AVG56226.1|2214384_2215362_+	pyruvate dehydrogenase E1 component subunit beta	NA	NA	NA	NA	NA
AVG56227.1|2215452_2216745_+	dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex	NA	NA	NA	NA	NA
AVG56228.1|2216748_2218155_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
AVG56229.1|2218322_2218598_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56230.1|2218741_2219281_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVG56231.1|2219293_2220388_+	spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
>prophage 157
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2228520	2230368	2878505		Erysipelothrix_phage(100.0%)	1	NA	NA
AVG56241.1|2228520_2230368_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 158
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2241885	2244793	2878505		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
AVG56253.1|2241885_2242812_-	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	2.2e-12
AVG56254.1|2243050_2243305_+	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
AVG56255.1|2243307_2243697_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56256.1|2243766_2244309_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AVG56257.1|2244310_2244793_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
>prophage 159
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2256739	2257798	2878505	tRNA	Orpheovirus(100.0%)	1	NA	NA
AVG56272.1|2256739_2257798_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 160
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2262800	2267358	2878505		Bodo_saltans_virus(33.33%)	3	NA	NA
AVG56277.1|2262800_2264513_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
AVG56278.1|2264522_2266871_+	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.4	3.2e-15
AVG56279.1|2267043_2267358_+	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
>prophage 161
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2280346	2284949	2878505		Staphylococcus_phage(100.0%)	5	NA	NA
AVG56917.1|2280346_2280565_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	52.5	2.8e-06
AVG56295.1|2280758_2280992_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56296.1|2282989_2283949_-	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
AVG56297.1|2284621_2284768_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56298.1|2284724_2284949_+	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
>prophage 162
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2293965	2294154	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG56307.1|2293965_2294154_+	DNA-binding protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	2.5e-19
>prophage 163
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2313737	2316491	2878505	tRNA	Orpheovirus(100.0%)	1	NA	NA
AVG56326.1|2313737_2316491_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 164
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2320955	2325566	2878505		Enterobacteria_phage(33.33%)	4	NA	NA
AVG56331.1|2320955_2322263_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
AVG56332.1|2322290_2323172_+	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
AVG56333.1|2323189_2324464_+	dihydroorotase	NA	NA	NA	NA	NA
AVG56334.1|2324465_2325566_+	carbamoyl-phosphate synthase small chain	NA	R4TGJ8	Halovirus	36.7	5.6e-63
>prophage 165
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2329533	2330145	2878505		Pandoravirus(100.0%)	1	NA	NA
AVG56337.1|2329533_2330145_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 166
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2333459	2335716	2878505		Abalone_herpesvirus(50.0%)	3	NA	NA
AVG56341.1|2333459_2334083_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	1.0e-21
AVG56342.1|2334082_2334301_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVG56343.1|2334516_2335716_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
>prophage 167
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2340728	2341664	2878505	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
AVG56348.1|2340728_2341664_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 168
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2344811	2346806	2878505		Moumouvirus(100.0%)	1	NA	NA
AVG56352.1|2344811_2346806_+	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 169
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2357176	2359426	2878505		Trichoplusia_ni_ascovirus(33.33%)	4	NA	NA
AVG56363.1|2357176_2357911_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
AVG56364.1|2358219_2358324_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56365.1|2358345_2358579_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
AVG56366.1|2358694_2359426_+	ribonuclease 3	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	29.2	2.6e-24
>prophage 170
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2372810	2386482	2878505	tRNA	Emiliania_huxleyi_virus(16.67%)	11	NA	NA
AVG56377.1|2372810_2373578_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
AVG56378.1|2373686_2374853_+	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AVG56379.1|2374874_2375783_+	succinyl-CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
AVG56380.1|2376009_2377128_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
AVG56381.1|2377155_2378400_+	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
AVG56921.1|2378704_2379445_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVG56382.1|2379618_2381694_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
AVG56383.1|2381849_2383157_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AVG56384.1|2383574_2384471_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	3.6e-31
AVG56385.1|2384467_2385013_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AVG56386.1|2385078_2386482_+	HslU--HslV peptidase ATPase subunit	NA	A0A1B2IDZ7	Erwinia_phage	25.6	2.9e-27
>prophage 171
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2391261	2392032	2878505		Flavobacterium_phage(100.0%)	1	NA	NA
AVG56393.1|2391261_2392032_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 172
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2396305	2408118	2878505	tRNA	Clostridium_phage(33.33%)	10	NA	NA
AVG56923.1|2396305_2400616_+	DNA polymerase III subunit alpha	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
AVG56397.1|2400725_2400926_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56398.1|2400905_2401373_+	ribosome maturation factor	NA	NA	NA	NA	NA
AVG56399.1|2401393_2402569_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AVG56400.1|2402589_2402874_+	DUF448 domain-containing protein	NA	NA	NA	NA	NA
AVG56401.1|2402870_2403188_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56402.1|2403192_2405310_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
AVG56403.1|2405695_2406046_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AVG56404.1|2406214_2407132_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AVG56405.1|2407146_2408118_+	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
>prophage 173
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2413258	2418799	2878505		Mycobacterium_phage(33.33%)	4	NA	NA
AVG56924.1|2413258_2415499_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
AVG56410.1|2415503_2416217_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVG56411.1|2416247_2417513_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
AVG56412.1|2417512_2418799_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.4	3.6e-16
>prophage 174
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2422997	2424041	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG56418.1|2422997_2424041_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 175
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2433455	2439937	2878505		Cafeteria_roenbergensis_virus(33.33%)	4	NA	NA
AVG56428.1|2433455_2436074_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
AVG56429.1|2436086_2438096_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.8e-60
AVG56430.1|2438101_2438644_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
AVG56431.1|2439118_2439937_+	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
>prophage 176
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2445879	2446356	2878505		Fowlpox_virus(100.0%)	1	NA	NA
AVG56437.1|2445879_2446356_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 177
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2451425	2455729	2878505	head	Staphylococcus_phage(80.0%)	8	NA	NA
AVG56442.1|2451425_2451623_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	50.0	9.9e-11
AVG56443.1|2452309_2452534_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	5.0e-19
AVG56444.1|2452827_2453034_+	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
AVG56445.1|2453733_2453844_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56446.1|2454267_2454453_+	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
AVG56447.1|2454963_2455068_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56448.1|2455195_2455447_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56449.1|2455492_2455729_+|head	phage head morphogenesis protein	head	Q4ZE35	Staphylococcus_virus	70.6	2.3e-22
>prophage 178
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2463854	2464388	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG56458.1|2463854_2464388_+	thermonuclease	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
>prophage 179
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2474526	2480182	2878505		Tupanvirus(25.0%)	7	NA	NA
AVG56468.1|2474526_2476044_+	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
AVG56469.1|2476134_2476284_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVG56470.1|2476737_2477007_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
AVG56471.1|2477163_2478141_+	guanosine monophosphate reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
AVG56472.1|2478137_2478242_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56473.1|2478315_2479179_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	9.1e-16
AVG56474.1|2479558_2480182_-	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	63.8	5.9e-17
>prophage 180
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2484332	2485454	2878505		Staphylococcus_phage(100.0%)	1	NA	NA
AVG56481.1|2484332_2485454_+	exonuclease sbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 181
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2489123	2490770	2878505		Vibrio_phage(100.0%)	1	NA	NA
AVG56484.1|2489123_2490770_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 182
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2496761	2501155	2878505		Bacillus_virus(50.0%)	2	NA	NA
AVG56927.1|2496761_2498753_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	1.0e-115
AVG56491.1|2498752_2501155_+	DNA topoisomerase 4 subunit A	NA	A0A172JHV7	Bacillus_phage	32.4	1.8e-93
>prophage 183
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2510814	2512077	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG56501.1|2510814_2512077_+	DNA repair protein	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 184
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2516395	2518750	2878505		Acinetobacter_phage(100.0%)	3	NA	NA
AVG56505.1|2516395_2516962_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
AVG56506.1|2516967_2517966_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	8.5e-34
AVG56507.1|2517967_2518750_+	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	35.9	2.7e-27
>prophage 185
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2526848	2527550	2878505		Tupanvirus(100.0%)	1	NA	NA
AVG56516.1|2526848_2527550_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.0e-13
>prophage 186
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2530964	2534418	2878505		Streptococcus_phage(50.0%)	3	NA	NA
AVG56522.1|2530964_2532779_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.1	5.1e-154
AVG56523.1|2532918_2533560_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AVG56524.1|2533566_2534418_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
>prophage 187
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2539507	2541109	2878505		Klosneuvirus(100.0%)	1	NA	NA
AVG56529.1|2539507_2541109_+	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 188
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2549156	2554187	2878505		Yellowstone_lake_phycodnavirus(33.33%)	8	NA	NA
AVG56537.1|2549156_2550422_+	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
AVG56538.1|2550661_2551063_-	protein msa	NA	NA	NA	NA	NA
AVG56539.1|2551259_2551460_-	cold-shock protein CspA	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
AVG56540.1|2551494_2551683_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56541.1|2551630_2551939_-	DUF1033 domain-containing protein	NA	NA	NA	NA	NA
AVG56542.1|2552101_2552371_+	acylphosphatase	NA	NA	NA	NA	NA
AVG56543.1|2552389_2553019_+	5-bromo-4-chloroindolyl phosphate hydrolase	NA	NA	NA	NA	NA
AVG56544.1|2553050_2554187_+	tellurite resistance protein TelA	NA	A0A291I9K4	Lactobacillus_phage	28.3	9.7e-34
>prophage 189
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2557728	2558520	2878505		Halovirus(100.0%)	1	NA	NA
AVG56547.1|2557728_2558520_-	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 190
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2564685	2566697	2878505		Hokovirus(50.0%)	2	NA	NA
AVG56552.1|2564685_2566041_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
AVG56553.1|2566037_2566697_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
>prophage 191
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2570106	2579496	2878505	protease	Staphylococcus_phage(60.0%)	13	NA	NA
AVG56558.1|2570106_2571597_-|protease	serine protease	protease	A0A0R6PIZ1	Moraxella_phage	30.2	2.3e-22
AVG56559.1|2571788_2572010_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56560.1|2572009_2572510_-	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AVG56561.1|2572521_2572950_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AVG56562.1|2572942_2573476_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AVG56563.1|2573561_2574401_-	fatty acid-binding protein DegV	NA	A0A0N9SI50	Staphylococcus_phage	76.5	1.5e-47
AVG56564.1|2574415_2574895_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
AVG56565.1|2575094_2576051_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
AVG56566.1|2576474_2576912_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
AVG56567.1|2576927_2578052_-	virulence factor C	NA	NA	NA	NA	NA
AVG56568.1|2578089_2578341_-	scaffolding protein	NA	NA	NA	NA	NA
AVG56569.1|2578352_2578574_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AVG56570.1|2578791_2579496_+	hypothetical protein	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
>prophage 192
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2618339	2619218	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG56576.1|2618339_2619218_-	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 193
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2628543	2629170	2878505		Bacillus_phage(100.0%)	1	NA	NA
AVG56586.1|2628543_2629170_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 194
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2632910	2640416	2878505	tRNA	Temperate_phage(25.0%)	5	NA	NA
AVG56590.1|2632910_2633597_-	DnaD domain protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
AVG56591.1|2633924_2635217_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.3	8.7e-55
AVG56592.1|2635538_2638232_-	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
AVG56593.1|2638255_2639227_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AVG56594.1|2639213_2640416_-	CCA-adding enzyme	NA	H7BUW3	unidentified_phage	43.3	4.2e-35
>prophage 195
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2643788	2644364	2878505		Bacillus_virus(100.0%)	1	NA	NA
AVG56598.1|2643788_2644364_-	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
>prophage 196
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2648026	2653493	2878505		Pandoravirus(25.0%)	8	NA	NA
AVG56602.1|2648026_2649193_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	31.8	5.8e-34
AVG56603.1|2649578_2649779_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56604.1|2649987_2650437_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
AVG56930.1|2650528_2651473_-	heptaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
AVG56605.1|2651489_2652215_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
AVG56606.1|2652217_2652790_-	heptaprenyl pyrophosphate synthase subunit A	NA	NA	NA	NA	NA
AVG56607.1|2652716_2653031_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56608.1|2653220_2653493_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
>prophage 197
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2662917	2665596	2878505		Moumouvirus(50.0%)	3	NA	NA
AVG56620.1|2662917_2664297_-	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	33.6	1.4e-55
AVG56621.1|2664286_2665240_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56622.1|2665347_2665596_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
>prophage 198
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2670024	2681634	2878505		Staphylococcus_phage(16.67%)	12	NA	NA
AVG56628.1|2670024_2672187_-	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	100.0	2.7e-109
AVG56629.1|2672179_2673106_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
AVG56630.1|2673349_2675101_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.2	2.2e-21
AVG56631.1|2675081_2675807_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
AVG56632.1|2675939_2676677_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AVG56633.1|2676669_2677212_-	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
AVG56634.1|2677204_2677936_-	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
AVG56635.1|2678027_2678534_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AVG56636.1|2678611_2679499_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
AVG56637.1|2679547_2679997_-	transcriptional repressor	NA	NA	NA	NA	NA
AVG56638.1|2680101_2680644_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVG56639.1|2680725_2681634_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	32.0	4.4e-05
>prophage 199
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2685161	2686646	2878505		Cyanophage(100.0%)	1	NA	NA
AVG56644.1|2685161_2686646_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 200
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2693072	2694479	2878505		Synechococcus_phage(100.0%)	1	NA	NA
AVG56651.1|2693072_2694479_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 201
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2701308	2707879	2878505		Indivirus(66.67%)	6	NA	NA
AVG56659.1|2701308_2702730_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	5.1e-40
AVG56660.1|2702880_2704560_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AVG56661.1|2704575_2705028_-	arginine repressor	NA	NA	NA	NA	NA
AVG56662.1|2705459_2706341_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	2.0e-10
AVG56663.1|2706318_2706549_-	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AVG56664.1|2706541_2707879_-	exodeoxyribonuclease 7 large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
>prophage 202
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2715379	2718191	2878505		Prochlorococcus_phage(100.0%)	2	NA	NA
AVG56675.1|2715379_2716852_-	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
AVG56676.1|2716844_2718191_-	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	39.2	1.7e-61
>prophage 203
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2723735	2724359	2878505		Streptococcus_phage(100.0%)	1	NA	NA
AVG56686.1|2723735_2724359_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 204
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2730532	2744278	2878505	tRNA	Klosneuvirus(28.57%)	13	NA	NA
AVG56694.1|2730532_2731132_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
AVG56695.1|2731407_2731818_-	transcriptional repressor	NA	NA	NA	NA	NA
AVG56696.1|2731804_2732668_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AVG56697.1|2732709_2733495_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
AVG56698.1|2733620_2734511_-	endonuclease	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
AVG56699.1|2734520_2735867_-	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
AVG56700.1|2735980_2737081_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AVG56701.1|2737083_2737761_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AVG56702.1|2737891_2738998_-	RNA polymerase sigma factor SigA	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
AVG56703.1|2739221_2741039_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.3	7.9e-54
AVG56704.1|2741099_2741918_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVG56705.1|2741928_2742552_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG56706.1|2742886_2744278_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
>prophage 205
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2747331	2748279	2878505		Rhizobium_phage(100.0%)	1	NA	NA
AVG56711.1|2747331_2748279_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 206
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2754749	2757857	2878505		Catovirus(50.0%)	2	NA	NA
AVG56718.1|2754749_2755889_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
AVG56719.1|2756024_2757857_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
>prophage 207
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2761350	2767514	2878505		Streptococcus_phage(33.33%)	5	NA	NA
AVG56722.1|2761350_2763174_-	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
AVG56723.1|2763519_2763771_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AVG56724.1|2763815_2764790_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AVG56725.1|2764846_2766994_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.6e-32
AVG56726.1|2767052_2767514_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
>prophage 208
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2774783	2777521	2878505		Staphylococcus_phage(50.0%)	3	NA	NA
AVG56738.1|2774783_2775023_-	carboxylate--amine ligase	NA	A0A1X9H080	Staphylococcus_phage	43.9	2.6e-13
AVG56739.1|2775120_2775594_-	enterotoxin	NA	NA	NA	NA	NA
AVG56740.1|2776300_2777521_-	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.3	2.2e-52
>prophage 209
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2784193	2819807	2878505	protease,tRNA	uncultured_Mediterranean_phage(18.75%)	33	NA	NA
AVG56748.1|2784193_2784817_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
AVG56749.1|2784816_2786085_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	31.7	4.0e-36
AVG56750.1|2786096_2787020_-	U32 family peptidase	NA	NA	NA	NA	NA
AVG56751.1|2787022_2787661_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	3.2e-10
AVG56752.1|2787945_2788254_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AVG56753.1|2788268_2788697_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AVG56754.1|2788700_2788961_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
AVG56755.1|2789023_2791654_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
AVG56756.1|2791996_2794474_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
AVG56757.1|2794475_2795144_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVG56758.1|2795508_2795595_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56759.1|2795558_2795717_-	nitrogen fixation protein NifR	NA	NA	NA	NA	NA
AVG56760.1|2795838_2796957_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVG56761.1|2796957_2798100_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.8	5.4e-32
AVG56762.1|2798411_2799431_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AVG56763.1|2799662_2799809_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56764.1|2799848_2800031_-	CsbD family protein	NA	NA	NA	NA	NA
AVG56765.1|2800130_2800553_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AVG56766.1|2800637_2801912_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.4e-105
AVG56767.1|2802072_2802846_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AVG56768.1|2802845_2802974_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56769.1|2803306_2805073_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
AVG56770.1|2805088_2806351_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AVG56771.1|2806811_2807687_-	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
AVG56772.1|2807683_2808136_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AVG56773.1|2808147_2810337_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
AVG56774.1|2810764_2811283_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
AVG56775.1|2811304_2813578_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.1e-64
AVG56776.1|2813780_2816060_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AVG56777.1|2816334_2816595_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AVG56778.1|2816613_2817753_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AVG56779.1|2817775_2818801_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVG56780.1|2818802_2819807_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 210
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2828374	2829106	2878505		Streptococcus_phage(100.0%)	1	NA	NA
AVG56794.1|2828374_2829106_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 211
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2832437	2839084	2878505	tRNA,transposase	Clostridium_phage(50.0%)	6	NA	NA
AVG56798.1|2832437_2833523_-|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
AVG56799.1|2833641_2834196_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AVG56800.1|2834192_2834900_-	prepilin peptidase	NA	NA	NA	NA	NA
AVG56801.1|2835001_2835112_+	hypothetical protein	NA	NA	NA	NA	NA
AVG56802.1|2835169_2836441_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AVG56803.1|2836453_2839084_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	2.8e-153
>prophage 212
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2848651	2859804	2878505	protease,tRNA	Bacillus_virus(20.0%)	12	NA	NA
AVG56814.1|2848651_2849914_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
AVG56815.1|2850064_2851366_-	trigger factor	NA	NA	NA	NA	NA
AVG56816.1|2851413_2851524_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56817.1|2851528_2852458_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56818.1|2852476_2853085_-	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
AVG56819.1|2853226_2853583_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVG56820.1|2853629_2853830_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVG56934.1|2853858_2854386_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
AVG56821.1|2854614_2856108_-	amino acid permease	NA	NA	NA	NA	NA
AVG56822.1|2856533_2858471_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.8	5.0e-115
AVG56823.1|2858668_2858791_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56824.1|2858883_2859804_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
>prophage 213
CP026958	Staphylococcus aureus strain FDAARGOS_40 chromosome, complete genome	2878505	2863719	2871883	2878505		Bacillus_virus(25.0%)	5	NA	NA
AVG56829.1|2863719_2864592_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
AVG56830.1|2864607_2867238_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
AVG56831.1|2867531_2869019_-	hypothetical protein	NA	NA	NA	NA	NA
AVG56935.1|2869517_2871179_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
AVG56832.1|2871178_2871883_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
