The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	0	27482	2873867	terminase,capsid,integrase,tail,head,portal	Staphylococcus_phage(86.79%)	53	11256:11269	30109:30122
AVG59737.1|1734_2079_-	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
AVG59738.1|2108_2474_-|tail	phage tail protein	tail	Q8SDT9	Staphylococcus_phage	100.0	2.8e-59
AVG59739.1|2535_3117_-|tail	phage major tail protein, TP901-1 family	tail	Q8SDU0	Staphylococcus_phage	100.0	4.9e-106
AVG59740.1|3135_3519_-	hypothetical protein	NA	Q8SDU1	Staphylococcus_phage	100.0	2.6e-68
AVG59741.1|3530_3878_-	hypothetical protein	NA	A0A0F6N3F5	Staphylococcus_phage	100.0	4.1e-60
AVG59742.1|3877_4180_-	hypothetical protein	NA	A4ZFB6	Staphylococcus_virus	100.0	1.1e-50
AVG59743.1|4176_4509_-|head,tail	phage head-tail adapter protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
AVG59744.1|4517_4805_-	hypothetical protein	NA	Q8SDU4	Staphylococcus_phage	100.0	6.2e-46
AVG59745.1|4826_5801_-|capsid	phage major capsid protein	capsid	Q8SDU5	Staphylococcus_phage	100.0	1.3e-183
AVG59746.1|5814_6435_-	DUF4355 domain-containing protein	NA	Q8SDU6	Staphylococcus_phage	100.0	6.4e-64
AVG59747.1|6543_6714_-	hypothetical protein	NA	Q4ZDV7	Staphylococcus_virus	100.0	3.3e-23
AVG59748.1|6786_7782_-|head	phage head morphogenesis protein	head	Q4ZDV8	Staphylococcus_virus	100.0	5.8e-184
AVG59749.1|7788_9324_-|portal	phage portal protein	portal	Q8SDU8	Staphylococcus_phage	100.0	3.1e-293
AVG59750.1|9334_10612_-|terminase	PBSX family phage terminase large subunit	terminase	Q8SDU9	Staphylococcus_phage	100.0	3.0e-249
AVG59751.1|10598_11039_-|terminase	terminase small subunit	terminase	Q8SDV0	Staphylococcus_phage	100.0	2.8e-74
AVG59752.1|11225_11648_-	transcriptional regulator	NA	Q8SDV1	Staphylococcus_phage	100.0	1.6e-74
11256:11269	attL	AGATATGATTTTTC	NA	NA	NA	NA
AVG59753.1|11671_11818_-	hypothetical protein	NA	A0A059T5A8	Staphylococcus_phage	100.0	2.2e-15
AVG59754.1|11818_12007_-	transcriptional regulator	NA	Q77FU4	Staphylococcus_phage	100.0	5.1e-25
AVG59755.1|11994_12195_-	hypothetical protein	NA	A0A2I6PF22	Staphylococcus_phage	98.5	4.0e-28
AVG59756.1|12169_12358_-	DUF1381 domain-containing protein	NA	A0A2I6PDV0	Staphylococcus_phage	100.0	2.1e-26
AVG59757.1|12354_12600_-	hypothetical protein	NA	Q9B0F1	Staphylococcus_virus	86.4	2.1e-26
AVG59758.1|12636_13146_-	dUTP pyrophosphatase	NA	Q8SDV3	Staphylococcus_phage	100.0	3.3e-90
AVG59759.1|13138_13381_-	hypothetical protein	NA	Q8SDV4	Staphylococcus_phage	100.0	1.6e-34
AVG59760.1|13377_13623_-	hypothetical protein	NA	Q8SDV5	Staphylococcus_phage	100.0	1.5e-37
AVG59761.1|13637_13886_-	hypothetical protein	NA	A0A2I6PDI0	Staphylococcus_phage	100.0	3.2e-43
AVG59762.1|13886_14246_-	hypothetical protein	NA	Q8SDV7	Staphylococcus_phage	100.0	3.5e-62
AVG59763.1|14246_14516_-	XRE family transcriptional regulator	NA	Q8SDV8	Staphylococcus_phage	100.0	1.2e-43
AVG59764.1|14516_14702_-	hypothetical protein	NA	Q8SDV9	Staphylococcus_phage	100.0	2.4e-27
AVG59765.1|14706_15111_-	hypothetical protein	NA	G4KNP2	Staphylococcus_phage	100.0	1.6e-68
AVG59766.1|15121_15343_-	DUF3269 domain-containing protein	NA	Q9G021	Staphylococcus_phage	100.0	1.3e-35
AVG59767.1|15346_15562_-	hypothetical protein	NA	Q4ZBU5	Staphylococcus_virus	100.0	4.8e-35
AVG59768.1|15558_16800_-	damage-inducible protein	NA	Q8SDW1	Staphylococcus_phage	100.0	5.7e-229
AVG59769.1|16796_17153_-	hypothetical protein	NA	B7T0A8	Staphylococcus_virus	97.5	2.2e-61
AVG59770.1|17152_17959_-	replication protein	NA	Q8SDW2	Staphylococcus_phage	100.0	2.1e-107
AVG59771.1|17930_18623_-	hypothetical protein	NA	Q8SDW3	Staphylococcus_phage	100.0	6.1e-132
AVG62544.1|18635_19136_-	single-strand DNA-binding protein	NA	A7TWM8	Staphylococcus_phage	100.0	7.2e-90
AVG59772.1|19219_19999_-	chromosomal replication initiator DnaA	NA	Q8SDW5	Staphylococcus_phage	100.0	2.5e-142
AVG59773.1|19999_20536_-	hypothetical protein	NA	A0A2I6PD93	Staphylococcus_phage	100.0	1.7e-81
AVG59774.1|20548_20869_-	hypothetical protein	NA	Q8SDW6	Staphylococcus_phage	100.0	5.8e-53
AVG59775.1|20789_21119_-	hypothetical protein	NA	D2JGJ7	Staphylococcus_phage	100.0	1.4e-33
AVG59776.1|21208_21370_-	DUF1270 domain-containing protein	NA	A0A2I6PDF7	Staphylococcus_phage	100.0	1.9e-20
AVG59777.1|21362_21584_-	hypothetical protein	NA	A0A0F6N3I2	Staphylococcus_phage	100.0	1.5e-31
AVG59778.1|21597_22047_-	hypothetical protein	NA	A0A0H3U2S4	Staphylococcus_phage	100.0	2.3e-79
AVG59779.1|22088_22313_-	hypothetical protein	NA	A0A0F6N4M2	Staphylococcus_phage	100.0	3.2e-34
AVG59780.1|22313_23105_-	phage antirepressor	NA	Q8SDX0	Staphylococcus_phage	100.0	1.5e-145
AVG59781.1|23261_23570_-	hypothetical protein	NA	S4V9P0	Staphylococcus_phage	100.0	1.3e-49
AVG59782.1|23584_23803_-	XRE family transcriptional regulator	NA	Q8SDX1	Staphylococcus_phage	100.0	2.9e-35
AVG59783.1|23944_24664_+	XRE family transcriptional regulator	NA	Q8SDX2	Staphylococcus_phage	100.0	9.8e-133
AVG59784.1|24733_24901_+	hypothetical protein	NA	Q4ZDJ4	Staphylococcus_virus	100.0	1.7e-24
AVG59785.1|25060_25246_+	hypothetical protein	NA	Q8SDX3	Staphylococcus_phage	100.0	6.6e-25
AVG59786.1|25281_26187_+	hypothetical protein	NA	A0A0F6N3N6	Staphylococcus_phage	100.0	1.4e-168
AVG59787.1|26123_26324_-	excisionase	NA	Q38044	Staphylococcus_phage	100.0	5.6e-30
AVG59788.1|26435_27482_+|integrase	site-specific integrase	integrase	Q38045	Staphylococcus_phage	100.0	4.2e-201
30109:30122	attR	AGATATGATTTTTC	NA	NA	NA	NA
>prophage 2
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	33514	34144	2873867		Bacillus_phage(100.0%)	1	NA	NA
AVG59795.1|33514_34144_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 3
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	39195	39609	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG62546.1|39195_39609_-	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	37.7	5.1e-17
>prophage 4
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	43060	48089	2873867		Staphylococcus_phage(33.33%)	5	NA	NA
AVG59806.1|43060_43615_+	DNA polymerase III subunit epsilon	NA	B5WZL1	Staphylococcus_phage	36.3	9.2e-30
AVG59807.1|43682_44753_-	DNA polymerase IV	NA	NA	NA	NA	NA
AVG59808.1|44999_45530_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
AVG59809.1|45699_47061_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.8	1.1e-103
AVG59810.1|47141_48089_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
>prophage 5
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	55264	149289	2873867	terminase,holin,capsid,integrase,tail,protease,head,portal	Staphylococcus_phage(88.24%)	122	126669:126685	152863:152879
AVG59817.1|55264_57268_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	5.8e-114
AVG59818.1|57271_59464_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
AVG59819.1|59460_60153_-	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
AVG59820.1|60324_60627_-	hypothetical protein	NA	NA	NA	NA	NA
AVG59821.1|60735_62031_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
AVG59822.1|62286_62481_+	hypothetical protein	NA	NA	NA	NA	NA
AVG59823.1|62891_64058_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
AVG59824.1|64088_64415_+	staphostatin A	NA	NA	NA	NA	NA
AVG59825.1|64706_64880_-	NETI motif-containing protein	NA	NA	NA	NA	NA
AVG59826.1|64860_65463_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
AVG59827.1|65733_66555_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	1.8e-69
AVG59828.1|66547_68017_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	4.5e-108
AVG59829.1|68200_69277_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
AVG59830.1|69296_70091_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AVG59831.1|70162_70270_+	hypothetical protein	NA	NA	NA	NA	NA
AVG59832.1|70280_71843_-	sodium-dependent dicarboxylate transporter SdcS	NA	NA	NA	NA	NA
AVG59833.1|72047_73145_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	1.9e-47
AVG59834.1|73516_74077_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
AVG59835.1|74129_75059_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AVG59836.1|75253_75427_-	hypothetical protein	NA	NA	NA	NA	NA
AVG59837.1|75478_76858_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVG59838.1|76977_78006_-	hypothetical protein	NA	NA	NA	NA	NA
AVG59839.1|78275_78677_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
AVG59840.1|79249_79423_-	hypothetical protein	NA	NA	NA	NA	NA
AVG59841.1|79873_80914_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
AVG59842.1|80970_81813_-	hypothetical protein	NA	NA	NA	NA	NA
AVG59843.1|81809_82367_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AVG59844.1|82426_82951_-	hypothetical protein	NA	NA	NA	NA	NA
AVG59845.1|83071_83635_+	thioredoxin family protein	NA	NA	NA	NA	NA
AVG59846.1|83700_84441_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
AVG59847.1|84440_85313_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
AVG59848.1|85309_85990_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
AVG59849.1|85990_86887_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
AVG59850.1|86883_87264_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVG59851.1|87522_87699_-	hypothetical protein	NA	NA	NA	NA	NA
AVG59852.1|87941_88040_-	hypothetical protein	NA	NA	NA	NA	NA
AVG59853.1|88239_89526_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVG59854.1|89849_90140_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AVG59855.1|90150_91905_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AVG59856.1|92290_92491_+	hypothetical protein	NA	A0A1P8L6A7	Staphylococcus_phage	100.0	3.4e-27
AVG59857.1|92862_93042_+	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
AVG59858.1|93065_93374_+	hypothetical protein	NA	M9NTD8	Staphylococcus_phage	77.5	9.3e-24
AVG59859.1|93352_93613_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
AVG59860.1|93665_94016_-	inhibitor	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
AVG59861.1|94698_95148_+	chemotaxis inhibitory protein	NA	A7TWR9	Staphylococcus_phage	100.0	1.5e-78
AVG59862.1|95242_95701_-	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
AVG59863.1|96227_96719_-	staphylokinase	NA	A0A1W6JQ12	Staphylococcus_phage	100.0	3.6e-86
AVG59864.1|96909_97665_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
AVG59865.1|97676_97931_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AVG59866.1|97982_98090_+	hypothetical protein	NA	NA	NA	NA	NA
AVG59867.1|98142_98319_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
AVG59868.1|98468_98765_-	DUF2951 domain-containing protein	NA	D2JLG2	Staphylococcus_phage	100.0	2.9e-46
AVG59869.1|98822_99110_-	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
AVG59870.1|99156_99309_-	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
AVG59871.1|99298_103084_-	hypothetical protein	NA	A0A1P8L6B8	Staphylococcus_phage	100.0	0.0e+00
AVG59872.1|103099_104590_-|tail	phage tail protein	tail	D2JLF8	Staphylococcus_phage	100.0	8.2e-299
AVG59873.1|104589_109242_-|tail	phage tail tape measure protein	tail	Q8SDK4	Staphylococcus_phage	100.0	0.0e+00
AVG59874.1|109297_109420_-	hypothetical protein	NA	D2JLF6	Staphylococcus_phage	100.0	6.9e-15
AVG59875.1|109479_109926_-	hypothetical protein	NA	D2JLF5	Staphylococcus_phage	100.0	5.4e-73
AVG59876.1|109990_110944_-|tail	phage tail protein	tail	A7TWD0	Staphylococcus_phage	100.0	6.2e-175
AVG59877.1|110944_111325_-	hypothetical protein	NA	D2JLF3	Staphylococcus_phage	100.0	5.8e-68
AVG59878.1|111321_111699_-	hypothetical protein	NA	D2JLF2	Staphylococcus_phage	100.0	1.1e-61
AVG59879.1|111698_112034_-|head,tail	head-tail adaptor protein	head,tail	A7TWC7	Staphylococcus_phage	100.0	1.1e-59
AVG59880.1|112020_112353_-|head,tail	phage head-tail adapter protein	head,tail	Q8SDK7	Staphylococcus_phage	100.0	3.7e-58
AVG59881.1|112361_112520_-	hypothetical protein	NA	D2JLE9	Staphylococcus_phage	100.0	3.2e-20
AVG59882.1|112555_113803_-|capsid	phage major capsid protein	capsid	Q8SDK8	Staphylococcus_phage	100.0	2.8e-215
AVG59883.1|113890_114475_-|head,protease	HK97 family phage prohead protease	head,protease	D2JLE7	Staphylococcus_phage	100.0	9.8e-107
AVG62548.1|114467_115658_-|portal	phage portal protein	portal	D2JLE6	Staphylococcus_phage	100.0	1.8e-224
AVG59884.1|115723_115963_-	hypothetical protein	NA	A7TWC1	Staphylococcus_phage	100.0	7.0e-35
AVG59885.1|115937_117632_-|terminase	phage terminase large subunit	terminase	D2JLE4	Staphylococcus_phage	100.0	0.0e+00
AVG59886.1|117634_118102_-|terminase	phage terminase small subunit P27 family	terminase	D2JLE3	Staphylococcus_phage	100.0	1.1e-81
AVG62549.1|118231_118576_-	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	100.0	4.2e-65
AVG59887.1|118591_119044_-	hypothetical protein	NA	Q8SDL2	Staphylococcus_phage	100.0	3.6e-80
AVG59888.1|119158_119629_-	hypothetical protein	NA	D2JLE0	Staphylococcus_phage	100.0	3.7e-72
AVG59889.1|119535_119748_+	hypothetical protein	NA	NA	NA	NA	NA
AVG59890.1|119651_119852_-	DUF1514 domain-containing protein	NA	D2JLD9	Staphylococcus_phage	100.0	1.4e-28
AVG59891.1|119851_120001_-	transcriptional regulator	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
AVG59892.1|119997_120204_-	DUF1381 domain-containing protein	NA	A0A1W6JPY0	Staphylococcus_phage	100.0	1.9e-20
AVG59893.1|120220_120394_-	hypothetical protein	NA	A0A1W6JQ45	Staphylococcus_phage	100.0	4.7e-25
AVG59894.1|120430_120967_-	dUTPase	NA	A0A1W6JQ21	Staphylococcus_phage	100.0	9.4e-96
AVG59895.1|120959_121154_-	hypothetical protein	NA	M1SVE4	Staphylococcus_phage	95.1	5.9e-24
AVG59896.1|121116_121371_-	hypothetical protein	NA	A0A1W6JQ06	Staphylococcus_phage	100.0	1.9e-38
AVG59897.1|121363_121753_-	acetyltransferase	NA	A0A1W6JPV7	Staphylococcus_phage	100.0	3.5e-68
AVG59898.1|121749_122097_-	hypothetical protein	NA	A0A1W6JPZ1	Staphylococcus_phage	100.0	5.9e-59
AVG59899.1|122160_122409_-	hypothetical protein	NA	A0A1W6JPX8	Staphylococcus_phage	100.0	2.5e-43
AVG59900.1|122409_122781_-	hypothetical protein	NA	A0A1W6JPY5	Staphylococcus_phage	100.0	7.5e-52
AVG59901.1|122781_122967_-	DUF3113 domain-containing protein	NA	A0A1W6JPY2	Staphylococcus_phage	100.0	8.3e-28
AVG59902.1|122971_123376_-	hypothetical protein	NA	A0A0H4ISQ5	Staphylococcus_phage	100.0	9.0e-67
AVG59903.1|123386_123608_-	DUF3269 domain-containing protein	NA	Q9G021	Staphylococcus_phage	100.0	1.3e-35
AVG59904.1|123620_123779_-	hypothetical protein	NA	A1KX06	Staphylococcus_virus	100.0	4.5e-22
AVG59905.1|123772_124552_-	DNA replication protein DnaC	NA	G4KNP1	Staphylococcus_phage	100.0	3.8e-146
AVG62550.1|124561_125332_-	replication protein	NA	A0A1W6JQ00	Staphylococcus_phage	100.0	6.4e-122
AVG59906.1|125397_125679_+	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	100.0	2.6e-49
AVG59907.1|125817_126489_-	hypothetical protein	NA	Q8SDM2	Staphylococcus_phage	100.0	4.4e-127
AVG59908.1|126501_127053_-	single-stranded DNA-binding protein	NA	Q4ZBM4	Staphylococcus_phage	100.0	3.4e-101
126669:126685	attL	GTTTAATAAATGAAAAA	NA	NA	NA	NA
AVG59909.1|127083_127863_-	chromosomal replication initiator DnaA	NA	A0A1W6JPW0	Staphylococcus_phage	100.0	3.3e-142
AVG59910.1|127855_128077_-	DUF2483 domain-containing protein	NA	A0A1W6JQ25	Staphylococcus_phage	100.0	9.3e-34
AVG59911.1|128086_128347_-	hypothetical protein	NA	A0A2I6PDH1	Staphylococcus_phage	100.0	2.6e-43
AVG59912.1|128439_128601_-	DUF1270 domain-containing protein	NA	A0A2I6PDF7	Staphylococcus_phage	100.0	1.9e-20
AVG59913.1|128597_128918_-	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
AVG59914.1|128976_129609_+	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
AVG59915.1|129623_129764_-	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
AVG59916.1|129794_129992_-	hypothetical protein	NA	Q8SDM8	Staphylococcus_phage	100.0	7.0e-33
AVG59917.1|130813_131353_+	hypothetical protein	NA	Q8SDN0	Staphylococcus_phage	100.0	1.7e-97
AVG59918.1|131376_131637_-	transcriptional regulator	NA	A7TW91	Staphylococcus_phage	100.0	2.7e-40
AVG59919.1|131654_131879_-	DUF739 domain-containing protein	NA	A7TW90	Staphylococcus_phage	100.0	4.5e-36
AVG59920.1|132037_132808_+	transcriptional regulator	NA	A0A1P8L6G7	Staphylococcus_phage	100.0	6.2e-141
AVG59921.1|133224_133371_+	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
AVG59922.1|133367_133982_-	ATPase	NA	A7TW88	Staphylococcus_phage	100.0	7.9e-107
AVG59923.1|134089_135127_+|integrase	site-specific integrase	integrase	A7TWL3	Staphylococcus_phage	100.0	3.4e-179
AVG59924.1|136245_137262_-	bi-component leukocidin LukGH subunit G	NA	A0A2I6PER8	Staphylococcus_phage	29.0	1.1e-25
AVG59925.1|137283_138339_-	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
AVG59926.1|138773_139997_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AVG59927.1|140368_141214_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVG59928.1|141275_142187_-	ferrichrome ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG59929.1|142347_143655_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
AVG59930.1|144507_144951_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVG59931.1|145056_145494_-	hypothetical protein	NA	NA	NA	NA	NA
AVG59932.1|145811_146402_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	95.8	1.1e-97
AVG59933.1|146398_146611_-	pathogenicity island family protein	NA	Q4ZE86	Staphylococcus_phage	74.3	1.1e-23
AVG59934.1|147312_148929_-	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
AVG59935.1|149004_149289_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
152863:152879	attR	TTTTTCATTTATTAAAC	NA	NA	NA	NA
>prophage 6
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	156468	170314	2873867	tRNA	uncultured_Caudovirales_phage(16.67%)	13	NA	NA
AVG59943.1|156468_157185_+	DNA-binding response regulator	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
AVG59944.1|157256_157364_+	hypothetical protein	NA	NA	NA	NA	NA
AVG59945.1|157551_158511_-	carbohydrate kinase	NA	NA	NA	NA	NA
AVG59946.1|158507_159992_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.6	4.0e-19
AVG59947.1|160140_161091_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AVG59948.1|161273_162524_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
AVG59949.1|162731_162956_-	oxidoreductase	NA	NA	NA	NA	NA
AVG62552.1|163015_164044_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AVG59950.1|164398_165034_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AVG59951.1|165286_167215_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	30.4	2.4e-53
AVG59952.1|167359_167488_-	hypothetical protein	NA	NA	NA	NA	NA
AVG59953.1|167576_169187_+	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	26.9	3.3e-19
AVG59954.1|169288_170314_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	6.9e-63
>prophage 7
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	174074	178798	2873867		Yellowstone_lake_phycodnavirus(50.0%)	4	NA	NA
AVG59959.1|174074_175844_+	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	5.3e-63
AVG59960.1|175843_176098_+	acetolactate synthase 1 regulatory subunit	NA	NA	NA	NA	NA
AVG59961.1|176234_177239_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AVG59962.1|177268_178798_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
>prophage 8
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	192481	195854	2873867		Bacillus_phage(50.0%)	5	NA	NA
AVG59970.1|192481_193252_-	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
AVG59971.1|193226_193706_-	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
AVG59972.1|193707_194034_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AVG59973.1|195293_195527_+	hypothetical protein	NA	NA	NA	NA	NA
AVG59974.1|195491_195854_-	mRNA interferase MazF	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
>prophage 9
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	201004	203032	2873867		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVG59982.1|201004_203032_-	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	5.6e-24
>prophage 10
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	208719	210240	2873867		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVG59987.1|208719_210240_-	DEAD/DEAH box family ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 11
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	217440	218088	2873867		Moumouvirus(100.0%)	1	NA	NA
AVG59995.1|217440_218088_+	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	6.1e-09
>prophage 12
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	224258	224654	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG60004.1|224258_224654_-	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 13
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	235058	242808	2873867		Catovirus(25.0%)	9	NA	NA
AVG60019.1|235058_236186_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
AVG60020.1|236209_236839_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVG60021.1|236866_238105_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
AVG60022.1|238131_238656_-	TIGR01440 family protein	NA	NA	NA	NA	NA
AVG60023.1|238762_239182_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AVG60024.1|239178_240276_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	7.9e-41
AVG60025.1|240308_241145_-	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AVG60026.1|241131_242208_-	peptide chain release factor 1	NA	NA	NA	NA	NA
AVG60027.1|242208_242808_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
>prophage 14
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	250611	252222	2873867		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AVG60035.1|250611_252222_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	3.5e-146
>prophage 15
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	260160	263992	2873867		Geobacillus_virus(50.0%)	5	NA	NA
AVG60044.1|260160_261462_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	2.7e-133
AVG60045.1|261445_261574_+	hypothetical protein	NA	NA	NA	NA	NA
AVG60046.1|261740_262403_-	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
AVG60047.1|262717_263428_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AVG60048.1|263548_263992_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
>prophage 16
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	276599	279419	2873867		Bacillus_phage(50.0%)	2	NA	NA
AVG60063.1|276599_277382_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.7e-08
AVG60064.1|277613_279419_-	glutamine--fructose-6-phosphate aminotransferase	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.0e-97
>prophage 17
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	285675	293112	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG60069.1|285675_293112_-	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	23.5	3.4e-18
>prophage 18
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	296702	297611	2873867		Klosneuvirus(100.0%)	1	NA	NA
AVG60073.1|296702_297611_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 19
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	314958	315927	2873867		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG60086.1|314958_315927_-	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.3e-15
>prophage 20
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	328084	329647	2873867		Vibrio_phage(100.0%)	1	NA	NA
AVG60097.1|328084_329647_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.0	5.4e-19
>prophage 21
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	333607	335020	2873867		Pandoravirus(100.0%)	1	NA	NA
AVG60101.1|333607_335020_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	5.0e-48
>prophage 22
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	341341	344436	2873867		Orpheovirus(50.0%)	5	NA	NA
AVG60107.1|341341_342082_+	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.4	7.3e-14
AVG60108.1|342118_342280_+	hypothetical protein	NA	NA	NA	NA	NA
AVG60109.1|342372_342981_-	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
AVG60110.1|343242_343368_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60111.1|343587_344436_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
>prophage 23
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	347812	357042	2873867	protease	Clostridium_phage(33.33%)	9	NA	NA
AVG60115.1|347812_348667_-	M23 family peptidase	NA	E5G070	Clostridium_phage	41.4	3.4e-07
AVG60116.1|348877_349693_-	hydrolase	NA	NA	NA	NA	NA
AVG60117.1|349986_350412_+	MAP domain-containing protein	NA	NA	NA	NA	NA
AVG60118.1|350775_351480_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
AVG60119.1|351516_353181_-	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
AVG60120.1|353413_353653_+	hypothetical protein	NA	NA	NA	NA	NA
AVG60121.1|353634_353817_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60122.1|354370_355777_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60123.1|355905_357042_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7SAX5	Vibrio_phage	27.0	5.4e-08
>prophage 24
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	362471	364138	2873867		Staphylococcus_phage(50.0%)	2	NA	NA
AVG60130.1|362471_363332_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	9.7e-10
AVG60131.1|363328_364138_-	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	2.2e-19
>prophage 25
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	387601	390769	2873867		Leptospira_phage(100.0%)	1	NA	NA
AVG60170.1|387601_390769_-	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	21.8	6.2e-62
>prophage 26
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	402855	403461	2873867		Pithovirus(100.0%)	1	NA	NA
AVG60188.1|402855_403461_-	molybdenum ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 27
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	422438	423242	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG60209.1|422438_423242_+	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.3e-07
>prophage 28
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	427158	431139	2873867		Staphylococcus_phage(50.0%)	5	NA	NA
AVG60214.1|427158_427659_+	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
AVG60215.1|427706_427964_+	hypothetical protein	NA	NA	NA	NA	NA
AVG60216.1|428020_428974_+	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	2.9e-31
AVG60217.1|429065_430190_-	hypothetical protein	NA	A0A2K9L3K5	Tupanvirus	22.8	5.5e-13
AVG62559.1|430500_431139_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
>prophage 29
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	444703	445339	2873867		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVG60230.1|444703_445339_-	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 30
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	453216	454098	2873867		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVG60237.1|453216_454098_-	KR domain-containing protein	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	2.2e-62
>prophage 31
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	459971	460391	2873867		Bacillus_phage(100.0%)	1	NA	NA
AVG60242.1|459971_460391_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	61.9	2.6e-37
>prophage 32
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	467763	468663	2873867		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVG60251.1|467763_468663_-	DUF4162 domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.2	4.2e-16
>prophage 33
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	480784	481993	2873867		Salmonella_phage(100.0%)	1	NA	NA
AVG60265.1|480784_481993_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.3	3.9e-33
>prophage 34
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	486572	490469	2873867		Planktothrix_phage(33.33%)	4	NA	NA
AVG60269.1|486572_487238_-	hemin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.2e-36
AVG60270.1|487237_488293_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AVG60271.1|488428_489103_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
AVG60272.1|489095_490469_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	1.3e-13
>prophage 35
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	500328	501363	2873867		Bacillus_virus(100.0%)	1	NA	NA
AVG60280.1|500328_501363_-	thioredoxin reductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 36
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	522781	524341	2873867		Escherichia_phage(100.0%)	1	NA	NA
AVG60305.1|522781_524341_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 37
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	540992	541724	2873867		Bacillus_virus(100.0%)	1	NA	NA
AVG60322.1|540992_541724_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 38
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	549668	555440	2873867		Staphylococcus_phage(75.0%)	6	NA	NA
AVG62566.1|549668_550598_+	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
AVG60333.1|551165_552113_+	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.1	1.2e-138
AVG60334.1|552114_553092_+	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
AVG60335.1|553143_553611_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60336.1|553621_554314_-	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
AVG60337.1|554324_555440_-	aminotransferase class V-fold PLP-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	1.6e-20
>prophage 39
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	558900	565087	2873867		Bacillus_phage(66.67%)	6	NA	NA
AVG60343.1|558900_560634_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
AVG60344.1|560658_562422_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	1.5e-36
AVG60345.1|562915_563023_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60346.1|563049_563157_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60347.1|563290_563677_-	GtrA family protein	NA	NA	NA	NA	NA
AVG60348.1|563944_565087_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
>prophage 40
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	582814	584673	2873867		Bacillus_virus(50.0%)	2	NA	NA
AVG60366.1|582814_583450_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
AVG60367.1|583446_584673_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 41
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	588366	592795	2873867		Pandoravirus(50.0%)	4	NA	NA
AVG60373.1|588366_589719_+	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
AVG62567.1|589780_590959_-	MFS transporter	NA	NA	NA	NA	NA
AVG60374.1|591363_592140_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AVG60375.1|592132_592795_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.2	6.5e-22
>prophage 42
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	599928	601486	2873867		Bacillus_virus(50.0%)	2	NA	NA
AVG60384.1|599928_600678_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	3.1e-20
AVG60385.1|600670_601486_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	1.8e-13
>prophage 43
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	614847	615543	2873867		Bacillus_phage(100.0%)	1	NA	NA
AVG60399.1|614847_615543_-	oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	8.6e-09
>prophage 44
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	622367	627548	2873867		Bacillus_phage(50.0%)	3	NA	NA
AVG60408.1|622367_625229_-	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	2.4e-28
AVG60409.1|625230_625623_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AVG60410.1|625739_627548_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.1	1.9e-95
>prophage 45
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	636888	637755	2873867		Bacillus_phage(100.0%)	1	NA	NA
AVG60418.1|636888_637755_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	52.6	1.3e-78
>prophage 46
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	658136	658832	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG60435.1|658136_658832_+	lantibiotic ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	3.0e-38
>prophage 47
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	668112	669105	2873867		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVG60444.1|668112_669105_+	D-lactate dehydrogenase	NA	M1HYB0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-36
>prophage 48
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	678691	685075	2873867		Powai_lake_megavirus(33.33%)	5	NA	NA
AVG60456.1|678691_679660_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	5.2e-12
AVG60457.1|679792_680137_-	thioredoxin	NA	NA	NA	NA	NA
AVG60458.1|680178_680589_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AVG60459.1|680968_683035_-	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
AVG60460.1|683335_685075_-	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.3	2.7e-35
>prophage 49
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	692958	695994	2873867	protease	Streptococcus_phage(50.0%)	2	NA	NA
AVG60469.1|692958_693480_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
AVG60470.1|693888_695994_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
>prophage 50
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	705235	709218	2873867		uncultured_virus(50.0%)	3	NA	NA
AVG60479.1|705235_707644_+	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	41.0	4.9e-128
AVG60480.1|707923_708130_+	copper resistance protein CopZ	NA	NA	NA	NA	NA
AVG60481.1|708219_709218_-	lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	33.0	1.2e-35
>prophage 51
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	717651	721440	2873867		Salmonella_virus(50.0%)	3	NA	NA
AVG60488.1|717651_719463_-	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
AVG60489.1|719974_720463_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVG60490.1|720738_721440_-	transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	4.0e-38
>prophage 52
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	749575	759689	2873867	holin	Klosneuvirus(50.0%)	9	NA	NA
AVG60522.1|749575_750913_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.0e-18
AVG60523.1|751170_751587_+	hypothetical protein	NA	NA	NA	NA	NA
AVG60524.1|751709_752600_+	class I fructose-bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	28.6	1.0e-06
AVG60525.1|752792_754289_-	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
AVG60526.1|754584_754914_+	hypothetical protein	NA	NA	NA	NA	NA
AVG60527.1|754973_756572_-	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
AVG60528.1|756765_757209_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVG60529.1|757489_757702_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60530.1|757979_759689_-|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
>prophage 53
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	765534	767918	2873867		Enterococcus_phage(100.0%)	2	NA	NA
AVG60538.1|765534_766071_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	49.4	8.6e-41
AVG60539.1|766067_767918_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.2e-235
>prophage 54
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	772970	773468	2873867		Canarypox_virus(100.0%)	1	NA	NA
AVG60545.1|772970_773468_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 55
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	776888	778639	2873867		Planktothrix_phage(50.0%)	2	NA	NA
AVG60550.1|776888_777644_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
AVG60551.1|777751_778639_-	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	2.5e-05
>prophage 56
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	804323	806183	2873867		Enterococcus_phage(100.0%)	1	NA	NA
AVG60572.1|804323_806183_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 57
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	832284	832977	2873867		Streptococcus_phage(100.0%)	1	NA	NA
AVG60591.1|832284_832977_-	capsular biosynthesis protein	NA	A0A1X9I5D6	Streptococcus_phage	38.0	1.7e-28
>prophage 58
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	845428	846442	2873867		Faustovirus(100.0%)	1	NA	NA
AVG60603.1|845428_846442_-	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.2	2.1e-08
>prophage 59
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	852071	853784	2873867		Planktothrix_phage(100.0%)	1	NA	NA
AVG60610.1|852071_853784_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 60
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	868041	868800	2873867		Planktothrix_phage(100.0%)	1	NA	NA
AVG60626.1|868041_868800_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 61
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	873100	876366	2873867		Lactococcus_phage(33.33%)	5	NA	NA
AVG60631.1|873100_873301_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
AVG60632.1|873427_873997_-	transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
AVG60633.1|874256_874652_-	DUF3147 domain-containing protein	NA	NA	NA	NA	NA
AVG60634.1|874719_875073_-	DUF3147 domain-containing protein	NA	NA	NA	NA	NA
AVG60635.1|875526_876366_-	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
>prophage 62
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	886448	895487	2873867	tRNA	Bacillus_virus(50.0%)	6	NA	NA
AVG60645.1|886448_888383_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
AVG60646.1|888419_891083_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	2.7e-119
AVG60647.1|891169_891982_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AVG60648.1|892307_893822_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.6	6.8e-91
AVG60649.1|894022_894211_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60650.1|894200_895487_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
>prophage 63
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	902180	912192	2873867		Bacillus_phage(40.0%)	8	NA	NA
AVG60657.1|902180_903581_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.4	2.4e-111
AVG60658.1|903630_903858_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60659.1|903858_905142_+	adenylosuccinate synthetase	NA	L7Y4J5	Megavirus	34.6	2.3e-68
AVG60660.1|906345_907047_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
AVG60661.1|907059_908886_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
AVG60662.1|908878_910213_+	hypothetical protein	NA	NA	NA	NA	NA
AVG60663.1|910213_911002_+	hypothetical protein	NA	NA	NA	NA	NA
AVG60664.1|911391_912192_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	4.6e-38
>prophage 64
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	919784	920852	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG60673.1|919784_920852_+	dihydroneopterin aldolase	NA	A0A2H4PQR9	Staphylococcus_phage	41.5	3.5e-09
>prophage 65
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	957934	962144	2873867		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AVG60700.1|957934_958933_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.2e-14
AVG60701.1|958929_959925_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVG60702.1|959940_960933_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG60703.1|961163_962144_+	siderophore biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
>prophage 66
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	970410	971613	2873867		Tupanvirus(100.0%)	1	NA	NA
AVG60710.1|970410_971613_+	siderophore biosynthesis PLP-dependent protein	NA	A0A2K9L4I2	Tupanvirus	20.8	1.1e-08
>prophage 67
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	974983	975964	2873867		Catovirus(100.0%)	1	NA	NA
AVG60717.1|974983_975964_+	NAD-dependent dehydratase	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
>prophage 68
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	980901	981501	2873867		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVG60722.1|980901_981501_+	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 69
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	989534	990308	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG60731.1|989534_990308_-	phosphonates import ATP-binding protein PhnC	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 70
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1001590	1008155	2873867		Catovirus(50.0%)	6	NA	NA
AVG60740.1|1001590_1002277_+	capsular biosynthesis protein	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
AVG60741.1|1002279_1003044_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AVG60742.1|1003063_1004887_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	4.0e-29
AVG60743.1|1004876_1005905_+	UDP-glucose 4-epimerase	NA	A0A1V0SAI8	Catovirus	35.0	4.3e-41
AVG60744.1|1005917_1007027_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AVG60745.1|1007030_1008155_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
>prophage 71
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1014990	1017475	2873867		Bacillus_phage(50.0%)	2	NA	NA
AVG60753.1|1014990_1016253_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	26.0	6.6e-23
AVG60754.1|1016329_1017475_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
>prophage 72
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1020815	1023813	2873867		Indivirus(50.0%)	4	NA	NA
AVG60758.1|1020815_1021775_+	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
AVG60759.1|1021836_1022040_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60760.1|1022218_1022731_+	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
AVG60761.1|1023072_1023813_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	6.5e-39
>prophage 73
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1027351	1037635	2873867		Catovirus(50.0%)	3	NA	NA
AVG60766.1|1027351_1028377_+	formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
AVG60767.1|1028762_1030013_+	MFS transporter	NA	NA	NA	NA	NA
AVG60768.1|1030459_1037635_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.5	1.0e-67
>prophage 74
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1042471	1043656	2873867		Klosneuvirus(100.0%)	1	NA	NA
AVG60773.1|1042471_1043656_-	ornithine aminotransferase 1	NA	A0A1V0SKB7	Klosneuvirus	29.2	9.2e-35
>prophage 75
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1061816	1063409	2873867		Planktothrix_phage(100.0%)	1	NA	NA
AVG60787.1|1061816_1063409_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.1e-22
>prophage 76
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1071944	1074003	2873867		Pontimonas_phage(50.0%)	2	NA	NA
AVG60794.1|1071944_1072523_+	M23 family peptidase	NA	A0A2K9VGT1	Pontimonas_phage	39.4	9.7e-14
AVG60795.1|1072905_1074003_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
>prophage 77
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1084213	1089572	2873867		Enterobacteria_phage(50.0%)	3	NA	NA
AVG60805.1|1084213_1085770_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
AVG60806.1|1085766_1086735_-	lipoprotein	NA	NA	NA	NA	NA
AVG60807.1|1087322_1089572_+	formate acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
>prophage 78
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1100644	1102150	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG60816.1|1100644_1102150_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	3.5e-39
>prophage 79
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1111025	1112555	2873867		Vibrio_phage(100.0%)	1	NA	NA
AVG60825.1|1111025_1112555_-	PTS glucose transporter subunit IIB	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 80
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1119770	1120814	2873867		Synechococcus_phage(100.0%)	1	NA	NA
AVG60834.1|1119770_1120814_+	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	4.6e-14
>prophage 81
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1130141	1134681	2873867		Catovirus(50.0%)	3	NA	NA
AVG60841.1|1130141_1131866_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
AVG60842.1|1132005_1132680_+	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
AVG60843.1|1132941_1134681_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
>prophage 82
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1138441	1139878	2873867		Pandoravirus(100.0%)	1	NA	NA
AVG60849.1|1138441_1139878_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	3.7e-30
>prophage 83
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1149167	1150829	2873867		Arthrobacter_phage(50.0%)	2	NA	NA
AVG60860.1|1149167_1150118_+	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
AVG60861.1|1150169_1150829_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
>prophage 84
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1162792	1167232	2873867		Mycobacterium_phage(100.0%)	1	NA	NA
AVG60873.1|1162792_1167232_+	protein EssC	NA	V5UPA0	Mycobacterium_phage	24.3	8.2e-28
>prophage 85
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1187435	1188113	2873867		Planktothrix_phage(100.0%)	1	NA	NA
AVG60902.1|1187435_1188113_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	9.2e-32
>prophage 86
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1206344	1209079	2873867		Tupanvirus(50.0%)	3	NA	NA
AVG60920.1|1206344_1207145_+	hypothetical protein	NA	A0A2K9L8X2	Tupanvirus	43.9	8.9e-42
AVG60921.1|1207134_1208079_+	deacetylase SIR2	NA	NA	NA	NA	NA
AVG60922.1|1208056_1209079_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	29.7	1.1e-09
>prophage 87
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1230291	1231134	2873867		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVG60946.1|1230291_1231134_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	7.7e-12
>prophage 88
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1241052	1249470	2873867	integrase,protease	Staphylococcus_phage(66.67%)	14	1230160:1230174	1252512:1252526
1230160:1230174	attL	TATTCAATTACTACT	NA	NA	NA	NA
AVG60954.1|1241052_1242156_-	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
AVG62593.1|1242363_1242702_+	hypothetical protein	NA	NA	NA	NA	NA
AVG60955.1|1242819_1243665_+	chromosome partitioning protein ParB	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
AVG60956.1|1243821_1244703_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AVG60957.1|1244732_1244936_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
AVG60958.1|1244947_1246045_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AVG60959.1|1246130_1246322_-	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
AVG60960.1|1246305_1246575_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60961.1|1246565_1246862_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AVG60962.1|1246882_1247386_+	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
AVG60963.1|1247437_1247680_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AVG62594.1|1247945_1248884_-|protease	CAAX protease	protease	NA	NA	NA	NA
AVG60964.1|1248922_1249234_-|integrase	integrase	integrase	Q4ZE80	Staphylococcus_phage	70.5	5.5e-24
AVG60965.1|1249311_1249470_-|integrase	integrase	integrase	Q4ZE80	Staphylococcus_phage	66.7	6.7e-10
1252512:1252526	attR	TATTCAATTACTACT	NA	NA	NA	NA
>prophage 89
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1255664	1257188	2873867		Enterococcus_phage(100.0%)	1	NA	NA
AVG60976.1|1255664_1257188_-	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.9e-40
>prophage 90
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1266148	1271598	2873867		Klosneuvirus(25.0%)	5	NA	NA
AVG60987.1|1266148_1267615_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
AVG60988.1|1267639_1269181_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
AVG60989.1|1269293_1269830_-	hypothetical protein	NA	NA	NA	NA	NA
AVG60990.1|1270222_1270927_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	37.6	2.6e-29
AVG60991.1|1271325_1271598_-	hypothetical protein	NA	A0A0C5AJ30	Paenibacillus_phage	50.6	1.3e-13
>prophage 91
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1285300	1288061	2873867		Staphylococcus_phage(100.0%)	2	NA	NA
AVG61008.1|1285300_1286857_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	99.2	6.8e-288
AVG61009.1|1286849_1288061_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.2	2.2e-44
>prophage 92
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1308311	1314549	2873867		Lactococcus_phage(33.33%)	6	NA	NA
AVG61028.1|1308311_1309226_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	6.6e-49
AVG61029.1|1309209_1310352_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AVG61030.1|1310645_1311671_+	methionine import ATP-binding protein MetN 1	NA	G9BWD6	Planktothrix_phage	37.3	8.2e-32
AVG61031.1|1311674_1312334_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG61032.1|1312370_1313213_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG61033.1|1313544_1314549_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7NU10	Lactobacillus_phage	41.2	1.6e-24
>prophage 93
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1331195	1332893	2873867		Streptococcus_virus(100.0%)	1	NA	NA
AVG61047.1|1331195_1332893_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 94
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1342563	1343181	2873867		Streptococcus_phage(100.0%)	1	NA	NA
AVG61053.1|1342563_1343181_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 95
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1347087	1350185	2873867	tRNA	Streptococcus_phage(50.0%)	2	NA	NA
AVG61060.1|1347087_1347927_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
AVG61061.1|1348211_1350185_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.9e-93
>prophage 96
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1356069	1358534	2873867		Tupanvirus(50.0%)	2	NA	NA
AVG61071.1|1356069_1357422_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A2K9L821	Tupanvirus	30.4	2.4e-23
AVG61072.1|1357568_1358534_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
>prophage 97
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1367790	1378062	2873867	tRNA	Klosneuvirus(16.67%)	10	NA	NA
AVG61082.1|1367790_1369086_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	A0A1V0SI91	Klosneuvirus	24.5	4.8e-13
AVG61083.1|1369090_1369630_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
AVG61084.1|1369886_1371980_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
AVG61085.1|1372208_1373090_+	redox-regulated molecular chaperone Hsp33	NA	NA	NA	NA	NA
AVG61086.1|1373268_1374201_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
AVG61087.1|1374416_1375220_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.3	1.3e-21
AVG61088.1|1375197_1375563_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AVG61089.1|1375559_1376036_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVG61090.1|1376429_1376522_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61091.1|1376574_1378062_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
>prophage 98
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1396993	1399450	2873867	protease	Escherichia_phage(100.0%)	1	NA	NA
AVG61099.1|1396993_1399450_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 99
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1405461	1410244	2873867	tRNA	Catovirus(50.0%)	8	NA	NA
AVG61104.1|1405461_1406862_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	3.2e-55
AVG61105.1|1406854_1407259_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
AVG61106.1|1407266_1408013_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AVG61107.1|1408012_1408537_+	NYN domain-containing protein	NA	NA	NA	NA	NA
AVG61108.1|1408617_1409187_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AVG61109.1|1409301_1409445_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVG61110.1|1409500_1409683_+	protein translocase subunit SecE	NA	NA	NA	NA	NA
AVG61111.1|1409695_1410244_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
>prophage 100
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1413927	1424881	2873867		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
AVG61117.1|1413927_1417479_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
AVG62601.1|1417642_1421239_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
AVG61118.1|1421375_1421630_+	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
AVG61119.1|1421727_1422141_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVG61120.1|1422206_1422677_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVG61121.1|1422799_1424881_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
>prophage 101
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1427909	1429097	2873867		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AVG61124.1|1427909_1429097_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	7.5e-45
>prophage 102
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1435675	1436338	2873867		Enterococcus_phage(100.0%)	1	NA	NA
AVG61131.1|1435675_1436338_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 103
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1455895	1459216	2873867		Burkholderia_virus(50.0%)	3	NA	NA
AVG61148.1|1455895_1457296_+	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
AVG61149.1|1457546_1457840_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61150.1|1457839_1459216_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
>prophage 104
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1462857	1463514	2873867		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
AVG61156.1|1462857_1463514_+	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 105
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1474819	1476142	2873867		Erysipelothrix_phage(100.0%)	1	NA	NA
AVG61170.1|1474819_1476142_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.3	2.2e-109
>prophage 106
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1489691	1493045	2873867		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
AVG61187.1|1489691_1490987_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	2.1e-24
AVG62604.1|1491014_1491536_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61188.1|1492034_1493045_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
>prophage 107
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1506116	1506677	2873867		Streptococcus_phage(100.0%)	1	NA	NA
AVG61202.1|1506116_1506677_+	recombinase	NA	A0A141E172	Streptococcus_phage	35.1	1.3e-18
>prophage 108
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1518103	1518847	2873867		Indivirus(100.0%)	1	NA	NA
AVG61213.1|1518103_1518847_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 109
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1525781	1529740	2873867		Streptomyces_phage(33.33%)	3	NA	NA
AVG61221.1|1525781_1526180_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
AVG61222.1|1526296_1527592_-	DUF1958 domain-containing protein	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
AVG61223.1|1528012_1529740_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
>prophage 110
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1532967	1533765	2873867		Planktothrix_phage(100.0%)	1	NA	NA
AVG61227.1|1532967_1533765_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 111
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1540287	1541331	2873867		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AVG61235.1|1540287_1541331_+	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 112
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1545705	1546467	2873867		Planktothrix_phage(100.0%)	1	NA	NA
AVG61242.1|1545705_1546467_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 113
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1551298	1552096	2873867		Bacillus_phage(100.0%)	1	NA	NA
AVG61246.1|1551298_1552096_-	peptidase M23	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 114
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1557358	1557832	2873867		Pandoravirus(100.0%)	1	NA	NA
AVG61250.1|1557358_1557832_+	cupin	NA	A0A291AU44	Pandoravirus	39.4	2.1e-14
>prophage 115
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1564691	1570971	2873867		Enterococcus_phage(33.33%)	6	NA	NA
AVG61261.1|1564691_1565258_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
AVG61262.1|1565259_1565718_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
AVG61263.1|1565720_1566404_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61264.1|1566575_1567451_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AVG61265.1|1567669_1569301_+	cysteine ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.8	6.7e-12
AVG61266.1|1569297_1570971_+	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	22.9	4.5e-11
>prophage 116
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1575948	1577322	2873867		Powai_lake_megavirus(100.0%)	1	NA	NA
AVG61272.1|1575948_1577322_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.0e-45
>prophage 117
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1588934	1598780	2873867		Staphylococcus_phage(12.5%)	12	NA	NA
AVG61284.1|1588934_1589774_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
AVG61285.1|1589905_1590889_+	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	43.3	1.5e-62
AVG61286.1|1590960_1592016_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.0	2.1e-14
AVG61287.1|1592015_1592702_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG61288.1|1592676_1593150_-	DoxX family protein	NA	NA	NA	NA	NA
AVG61289.1|1593491_1593932_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61290.1|1594211_1594796_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61291.1|1594894_1595608_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AVG61292.1|1595611_1596031_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AVG61293.1|1596032_1596701_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AVG61294.1|1597051_1597645_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
AVG61295.1|1597628_1598780_+	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	35.7	1.6e-23
>prophage 118
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1601919	1625483	2873867		uncultured_Caudovirales_phage(35.71%)	23	NA	NA
AVG61300.1|1601919_1603860_+	lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
AVG61301.1|1604130_1606014_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
AVG61302.1|1606025_1607807_+	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
AVG61303.1|1608028_1609006_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
AVG61304.1|1608998_1610513_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AVG61305.1|1610752_1611811_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
AVG61306.1|1612161_1612704_+	5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AVG61307.1|1612816_1612915_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61308.1|1613327_1614245_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	3.7e-07
AVG61309.1|1614335_1614437_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61310.1|1614514_1616020_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AVG61311.1|1616085_1616331_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61312.1|1616360_1616861_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AVG61313.1|1616880_1617747_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVG61314.1|1618131_1618398_+	ribonucleoside-diphosphate reductase	NA	NA	NA	NA	NA
AVG61315.1|1618547_1618946_+	protein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AVG61316.1|1618908_1621014_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AVG61317.1|1621131_1622103_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AVG61318.1|1622235_1622340_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61319.1|1622616_1622772_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62609.1|1622810_1623782_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
AVG61320.1|1623768_1624725_+	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
AVG61321.1|1624721_1625483_+	iron ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
>prophage 119
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1634765	1639993	2873867		Streptococcus_phage(66.67%)	5	NA	NA
AVG61332.1|1634765_1635836_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
AVG61333.1|1636153_1637209_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AVG61334.1|1637378_1638020_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
AVG61335.1|1638163_1638547_+	6-phosphogluconate dehydratase	NA	NA	NA	NA	NA
AVG61336.1|1638910_1639993_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	1.3e-43
>prophage 120
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1646071	1646911	2873867		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG61343.1|1646071_1646911_+	peptidase M23	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 121
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1650229	1653076	2873867		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVG61347.1|1650229_1653076_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
>prophage 122
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1657521	1663568	2873867	protease	Streptococcus_phage(40.0%)	6	NA	NA
AVG61352.1|1657521_1658457_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
AVG61353.1|1658830_1659049_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61354.1|1659450_1660362_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
AVG61355.1|1660358_1661354_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
AVG61356.1|1661463_1662408_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
AVG61357.1|1662980_1663568_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
>prophage 123
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1672624	1681502	2873867		Staphylococcus_phage(50.0%)	10	NA	NA
AVG61365.1|1672624_1673929_+	enolase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
AVG61366.1|1674268_1674727_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61367.1|1674793_1675027_+	protein-export membrane protein SecG	NA	NA	NA	NA	NA
AVG61368.1|1675142_1675883_+	carboxylesterase	NA	NA	NA	NA	NA
AVG61369.1|1675916_1678289_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.2	2.7e-94
AVG61370.1|1678310_1678775_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
AVG61371.1|1679548_1679830_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61372.1|1680096_1680420_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62610.1|1680435_1680582_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61373.1|1680773_1681502_-	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	37.5	1.3e-18
>prophage 124
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1690601	1691845	2873867		Bacillus_phage(50.0%)	2	NA	NA
AVG61380.1|1690601_1691288_+	thermonuclease	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
AVG61381.1|1691644_1691845_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
>prophage 125
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1695249	1700426	2873867		Streptococcus_phage(50.0%)	8	NA	NA
AVG62611.1|1695249_1695810_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.4	3.8e-31
AVG61389.1|1695882_1696500_-	amino acid transporter	NA	NA	NA	NA	NA
AVG61390.1|1696654_1697149_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVG61391.1|1697547_1697970_-	organic hydroperoxide reductase OsmC/OhrA	NA	NA	NA	NA	NA
AVG61392.1|1698117_1698834_+	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	30.6	3.0e-17
AVG61393.1|1698916_1699456_+	nitroreductase	NA	NA	NA	NA	NA
AVG61394.1|1699605_1699926_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
AVG61395.1|1700069_1700426_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
>prophage 126
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1703687	1704713	2873867		Planktothrix_phage(100.0%)	1	NA	NA
AVG61402.1|1703687_1704713_+	methionine import ATP-binding protein MetN 2	NA	G9BWD6	Planktothrix_phage	36.8	1.2e-27
>prophage 127
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1708199	1711722	2873867		Indivirus(50.0%)	3	NA	NA
AVG61407.1|1708199_1708961_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
AVG61408.1|1709058_1710366_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AVG61409.1|1710480_1711722_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
>prophage 128
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1724842	1727511	2873867		Tupanvirus(50.0%)	2	NA	NA
AVG61429.1|1724842_1726300_+	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
AVG61430.1|1726296_1727511_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
>prophage 129
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1731554	1735182	2873867		Lake_Baikal_phage(50.0%)	3	NA	NA
AVG61437.1|1731554_1731914_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
AVG61438.1|1732367_1733576_+	NADH dehydrogenase	NA	NA	NA	NA	NA
AVG61439.1|1733706_1735182_+	aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	6.9e-48
>prophage 130
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1745102	1752261	2873867		Aureococcus_anophage(33.33%)	7	NA	NA
AVG61450.1|1745102_1745696_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
AVG61451.1|1746111_1746489_+	general stress protein	NA	NA	NA	NA	NA
AVG61452.1|1746850_1747978_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
AVG61453.1|1748285_1749476_+	Ornithine aminotransferase 2	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
AVG61454.1|1749584_1750829_+	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
AVG61455.1|1751054_1751246_+	nitrogen fixation protein NifR	NA	NA	NA	NA	NA
AVG61456.1|1751331_1752261_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
>prophage 131
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1762415	1766069	2873867		Bacillus_phage(100.0%)	1	NA	NA
AVG61464.1|1762415_1766069_+	ATP-dependent helicase/nuclease subunit A	NA	A7KV33	Bacillus_phage	24.5	3.5e-24
>prophage 132
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1771186	1777996	2873867		Pseudomonas_phage(33.33%)	4	NA	NA
AVG61470.1|1771186_1773001_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	1.1e-36
AVG61471.1|1773203_1775813_+	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
AVG61472.1|1775871_1776741_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG61473.1|1776850_1777996_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	2.5e-05
>prophage 133
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1786591	1788605	2873867		Planktothrix_phage(50.0%)	2	NA	NA
AVG61484.1|1786591_1787674_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
AVG61485.1|1787663_1788605_+	peptide ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
>prophage 134
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1792256	1850993	2873867	protease,holin,tRNA,bacteriocin	Bacillus_virus(22.22%)	60	NA	NA
AVG61488.1|1792256_1793243_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	1.0e-15
AVG61489.1|1793245_1794226_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
AVG61490.1|1794218_1795181_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG61491.1|1795192_1796074_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG61492.1|1796115_1797105_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVG61493.1|1797399_1797795_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AVG61494.1|1798165_1798885_+	adaptor protein MecA	NA	NA	NA	NA	NA
AVG61495.1|1799005_1799992_+	competence protein CoiA	NA	NA	NA	NA	NA
AVG61496.1|1800039_1801848_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.4	9.3e-47
AVG61497.1|1802307_1803114_-	DsbA family protein	NA	NA	NA	NA	NA
AVG61498.1|1803136_1803502_-	globin	NA	NA	NA	NA	NA
AVG61499.1|1803605_1804199_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AVG61500.1|1804384_1804732_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61501.1|1804748_1805384_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AVG61502.1|1805400_1806210_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVG61503.1|1806206_1807061_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AVG61504.1|1807081_1808467_+	magnesium transporter	NA	NA	NA	NA	NA
AVG61505.1|1808476_1810321_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVG61506.1|1810598_1811369_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVG61507.1|1811563_1812649_-	AI-2E family transporter	NA	NA	NA	NA	NA
AVG61508.1|1812990_1814559_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AVG61509.1|1814700_1815459_+	esterase family protein	NA	NA	NA	NA	NA
AVG61510.1|1815652_1816162_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61511.1|1816274_1817483_-	MFS transporter	NA	NA	NA	NA	NA
AVG61512.1|1817442_1818618_-	diacylglycerol beta-glucosyltransferase	NA	NA	NA	NA	NA
AVG61513.1|1819050_1820532_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AVG61514.1|1820515_1820776_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61515.1|1820775_1822338_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	4.9e-36
AVG61516.1|1822639_1823443_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AVG61517.1|1823661_1825986_+|protease	serine protease	protease	W5SAB9	Pithovirus	27.1	8.1e-11
AVG61518.1|1826002_1827361_+	Ktr system potassium uptake protein D	NA	NA	NA	NA	NA
AVG61519.1|1827499_1829011_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AVG61520.1|1829497_1830067_-	competence protein ComK	NA	NA	NA	NA	NA
AVG61521.1|1830276_1830495_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AVG61522.1|1830575_1831562_-	lipoate--protein ligase	NA	NA	NA	NA	NA
AVG61523.1|1831760_1831937_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AVG61524.1|1831951_1832554_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG62613.1|1832854_1832932_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AVG61525.1|1833470_1833572_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62614.1|1833581_1833854_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AVG61526.1|1833897_1835862_+	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
AVG61527.1|1835864_1836185_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61528.1|1836181_1836823_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	2.2e-19
AVG61529.1|1836910_1837201_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61530.1|1837479_1837767_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61531.1|1837772_1839254_+	glycosyl transferase family 1	NA	NA	NA	NA	NA
AVG61532.1|1839342_1839699_-	DoxX family protein	NA	NA	NA	NA	NA
AVG61533.1|1840186_1841146_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG61534.1|1841191_1841323_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61535.1|1841386_1841677_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
AVG61536.1|1841766_1842318_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVG61537.1|1842368_1843307_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVG61538.1|1843457_1843562_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61539.1|1843638_1844850_+	isochorismate synthase	NA	NA	NA	NA	NA
AVG61540.1|1844836_1846510_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVG61541.1|1846496_1847300_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVG61542.1|1847292_1848114_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AVG61543.1|1848352_1848682_-	staphostatin B	NA	NA	NA	NA	NA
AVG61544.1|1848719_1849901_-|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
AVG61545.1|1849982_1850993_-|protease	serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	32.3	6.2e-16
>prophage 135
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1854659	1858430	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG61550.1|1854659_1858430_-	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.9e-54
>prophage 136
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1868827	1883587	2873867		Synechococcus_phage(22.22%)	14	NA	NA
AVG61561.1|1868827_1869688_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.2	5.3e-40
AVG61562.1|1869888_1870371_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
AVG61563.1|1870357_1871482_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVG61564.1|1871485_1872190_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
AVG61565.1|1872189_1872453_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVG61566.1|1872454_1873126_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVG61567.1|1873118_1875308_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	1.0e-140
AVG61568.1|1875286_1876771_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
AVG61569.1|1876763_1877792_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	1.3e-61
AVG61570.1|1877794_1878361_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
AVG61571.1|1878375_1879854_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
AVG61572.1|1879875_1881123_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AVG61573.1|1881387_1882194_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AVG61574.1|1882186_1883587_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
>prophage 137
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1886766	1891146	2873867		Streptococcus_phage(50.0%)	5	NA	NA
AVG61579.1|1886766_1887939_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	9.0e-75
AVG61580.1|1887992_1888535_+	DUF697 domain-containing protein	NA	NA	NA	NA	NA
AVG61581.1|1888688_1888955_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVG61582.1|1888957_1890676_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AVG61583.1|1890912_1891146_-	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
>prophage 138
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1897260	1906093	2873867		Synechococcus_phage(25.0%)	9	NA	NA
AVG61590.1|1897260_1897812_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
AVG61591.1|1898176_1898803_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61592.1|1898973_1900086_+	pyruvate dehydrogenase E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
AVG61593.1|1900089_1901067_+	pyruvate dehydrogenase E1 component subunit beta	NA	NA	NA	NA	NA
AVG61594.1|1901157_1902450_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
AVG61595.1|1902453_1903860_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.6e-46
AVG61596.1|1904027_1904303_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61597.1|1904446_1904986_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVG61598.1|1904998_1906093_+	spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
>prophage 139
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1914228	1916076	2873867		Erysipelothrix_phage(100.0%)	1	NA	NA
AVG61608.1|1914228_1916076_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 140
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	1927593	2008024	2873867	terminase,plate,transposase,capsid,holin,tail,tRNA,head,portal	Staphylococcus_phage(63.38%)	101	NA	NA
AVG61620.1|1927593_1928520_-	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	1.7e-12
AVG61621.1|1928758_1929013_+	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
AVG61622.1|1929015_1929405_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61623.1|1929474_1930017_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AVG61624.1|1930018_1930501_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
AVG61625.1|1930562_1931702_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AVG61626.1|1931828_1932386_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AVG61627.1|1932297_1932522_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61628.1|1932465_1932639_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AVG61629.1|1932755_1934141_-	recombinase family protein	NA	I1W625	Staphylococcus_phage	100.0	2.5e-265
AVG61630.1|1934248_1934449_+	excisionase	NA	Q38044	Staphylococcus_phage	100.0	5.6e-30
AVG61631.1|1934385_1935291_-	hypothetical protein	NA	A0A0F6N3N6	Staphylococcus_phage	100.0	1.4e-168
AVG61632.1|1935326_1935512_-	hypothetical protein	NA	Q8SDX3	Staphylococcus_phage	100.0	6.6e-25
AVG61633.1|1935671_1935839_-	hypothetical protein	NA	Q4ZDJ4	Staphylococcus_virus	100.0	1.7e-24
AVG61634.1|1935908_1936625_-	helix-turn-helix domain-containing protein	NA	A4ZF72	Staphylococcus_virus	100.0	4.6e-130
AVG61635.1|1936788_1937031_+	transcriptional regulator	NA	R9QSU1	Staphylococcus_phage	100.0	9.5e-40
AVG61636.1|1937046_1937835_+	phage antirepressor	NA	R9QSV3	Staphylococcus_phage	100.0	1.2e-144
AVG61637.1|1937850_1938045_+	hypothetical protein	NA	A4ZF75	Staphylococcus_virus	100.0	4.3e-19
AVG61638.1|1938248_1938479_-	hypothetical protein	NA	R4IG40	Staphylococcus_phage	100.0	2.3e-35
AVG61639.1|1938658_1938820_+	DUF1270 domain-containing protein	NA	A4ZF79	Staphylococcus_virus	100.0	2.5e-20
AVG61640.1|1938911_1939172_+	DUF1108 domain-containing protein	NA	Q4ZAZ5	Staphylococcus_virus	100.0	1.5e-43
AVG61641.1|1939181_1939403_+	DUF2483 domain-containing protein	NA	A0A1X9H047	Staphylococcus_phage	100.0	1.2e-33
AVG61642.1|1939395_1940019_+	DUF1071 domain-containing protein	NA	A0A2H4PQQ6	Staphylococcus_phage	100.0	1.4e-114
AVG61643.1|1940018_1940447_+	single-stranded DNA-binding protein	NA	A0A2H4JHI1	uncultured_Caudovirales_phage	93.0	1.2e-53
AVG61644.1|1940460_1941135_+	hypothetical protein	NA	Q4ZD97	Staphylococcus_virus	100.0	2.8e-129
AVG61645.1|1941240_1942098_-	DUF4393 domain-containing protein	NA	Q4ZBL8	Staphylococcus_phage	100.0	9.5e-159
AVG61646.1|1942162_1942933_+	replication protein	NA	A0A1W6JQ00	Staphylococcus_phage	100.0	6.4e-122
AVG61647.1|1942942_1943722_+	DNA replication protein DnaC	NA	G4KNP1	Staphylococcus_phage	100.0	3.8e-146
AVG61648.1|1943715_1943874_+	hypothetical protein	NA	A0A2H4PQI7	Staphylococcus_phage	100.0	4.5e-22
AVG61649.1|1943886_1944108_+	hypothetical protein	NA	A7TWN4	Staphylococcus_phage	100.0	1.3e-35
AVG61650.1|1944117_1944525_+	RusA family crossover junction endodeoxyribonuclease	NA	D2JGK8	Staphylococcus_phage	100.0	1.7e-73
AVG61651.1|1944524_1944710_+	hypothetical protein	NA	D2JGK9	Staphylococcus_phage	100.0	7.0e-27
AVG61652.1|1944710_1945070_+	hypothetical protein	NA	A4ZF92	Staphylococcus_virus	100.0	4.5e-62
AVG61653.1|1945070_1945319_+	hypothetical protein	NA	A4ZF93	Staphylococcus_virus	100.0	9.4e-43
AVG61654.1|1945333_1945735_+	hypothetical protein	NA	Q4ZDG8	Staphylococcus_virus	100.0	1.6e-71
AVG61655.1|1945731_1946079_+	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
AVG61656.1|1946075_1946384_+	hypothetical protein	NA	Q4ZDG6	Staphylococcus_virus	100.0	3.6e-52
AVG61657.1|1946376_1946613_+	hypothetical protein	NA	A4ZF97	Staphylococcus_virus	100.0	6.2e-36
AVG61658.1|1946617_1947130_+	dUTP pyrophosphatase	NA	Q4ZDG4	Staphylococcus_virus	100.0	2.5e-90
AVG61659.1|1947166_1947373_+	DUF1381 domain-containing protein	NA	A7TWH8	Staphylococcus_phage	100.0	9.9e-30
AVG61660.1|1947369_1947573_+	hypothetical protein	NA	A7TWH9	Staphylococcus_phage	100.0	8.8e-31
AVG61661.1|1947565_1947802_+	hypothetical protein	NA	Q4ZDG1	Staphylococcus_virus	100.0	6.2e-36
AVG61662.1|1947785_1948181_+	hypothetical protein	NA	A7TWI1	Staphylococcus_phage	100.0	3.3e-66
AVG61663.1|1948177_1948351_+	transcriptional regulator	NA	Q4ZDF9	Staphylococcus_virus	100.0	3.7e-22
AVG61664.1|1948351_1948498_+	hypothetical protein	NA	B2ZYX7	Staphylococcus_phage	100.0	2.2e-15
AVG61665.1|1948521_1948944_+	transcriptional regulator	NA	Q8SDV1	Staphylococcus_phage	100.0	1.6e-74
AVG61666.1|1949130_1949571_+|terminase	terminase small subunit	terminase	Q8SDV0	Staphylococcus_phage	100.0	2.8e-74
AVG61667.1|1949557_1950835_+|terminase	PBSX family phage terminase large subunit	terminase	Q8SDU9	Staphylococcus_phage	100.0	3.0e-249
AVG61668.1|1950845_1952381_+|portal	phage portal protein	portal	Q4ZDN2	Staphylococcus_virus	99.8	2.2e-291
AVG61669.1|1952387_1953383_+|head	phage head morphogenesis protein	head	Q4ZDV8	Staphylococcus_virus	100.0	5.8e-184
AVG61670.1|1953455_1953626_+	hypothetical protein	NA	Q4ZDV7	Staphylococcus_virus	100.0	3.3e-23
AVG61671.1|1953734_1954355_+	DUF4355 domain-containing protein	NA	Q4ZDM9	Staphylococcus_virus	100.0	1.1e-63
AVG61672.1|1954368_1955343_+|capsid	phage major capsid protein	capsid	Q4ZDM8	Staphylococcus_virus	100.0	2.2e-183
AVG61673.1|1955364_1955652_+	hypothetical protein	NA	Q8SDU4	Staphylococcus_phage	100.0	6.2e-46
AVG61674.1|1955660_1955993_+|head,tail	phage head-tail adapter protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
AVG61675.1|1955989_1956292_+	hypothetical protein	NA	A4ZFB6	Staphylococcus_virus	100.0	1.1e-50
AVG61676.1|1956291_1956639_+	hypothetical protein	NA	A0A0F6N3F5	Staphylococcus_phage	100.0	4.1e-60
AVG61677.1|1956650_1957034_+	hypothetical protein	NA	Q8SDU1	Staphylococcus_phage	100.0	2.6e-68
AVG61678.1|1957052_1957634_+|tail	phage major tail protein, TP901-1 family	tail	Q4ZDM3	Staphylococcus_virus	99.5	2.0e-104
AVG61679.1|1957695_1958061_+|tail	phage tail protein	tail	A0A0F6N4J9	Staphylococcus_phage	100.0	3.6e-59
AVG61680.1|1958090_1958435_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
AVG61681.1|1961929_1962877_+|tail	phage tail family protein	tail	Q8SDT6	Staphylococcus_phage	100.0	2.1e-183
AVG61682.1|1962885_1964787_+	peptidase	NA	Q8SDT5	Staphylococcus_phage	100.0	0.0e+00
AVG61683.1|1964801_1966712_+	hypothetical protein	NA	Q8SDT4	Staphylococcus_phage	100.0	0.0e+00
AVG61684.1|1966711_1968535_+|plate	phage baseplate upper protein	plate	B1H3M3	Staphylococcus_phage	100.0	0.0e+00
AVG61685.1|1968534_1968912_+	hypothetical protein	NA	A0A0F6N3G4	Staphylococcus_phage	100.0	1.5e-60
AVG61686.1|1968915_1969089_+	XkdX family protein	NA	A0A0F6N3L7	Staphylococcus_phage	100.0	6.6e-27
AVG62616.1|1969128_1969428_+	hypothetical protein	NA	A0A0H4ITZ0	Staphylococcus_phage	100.0	7.6e-47
AVG61687.1|1969564_1971463_+	CHAP domain-containing protein	NA	Q8SDT1	Staphylococcus_phage	100.0	0.0e+00
AVG61688.1|1971475_1972648_+|tail	phage tail protein	tail	Q8SDT0	Staphylococcus_phage	100.0	2.9e-198
AVG61689.1|1972653_1973049_+	hypothetical protein	NA	Q8SDS9	Staphylococcus_phage	100.0	1.6e-68
AVG61690.1|1973104_1973542_+|holin	phage holin	holin	Q8SDS8	Staphylococcus_phage	100.0	5.3e-73
AVG61691.1|1973522_1974968_+	autolysin	NA	Q8SDS7	Staphylococcus_phage	100.0	2.8e-296
AVG61692.1|1975211_1975364_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
AVG61693.1|1975434_1975545_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
AVG61694.1|1975531_1975732_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
AVG61695.1|1976057_1976159_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61696.1|1976485_1976647_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61697.1|1976777_1977293_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AVG61698.1|1977633_1978443_+	monofunctional glycosyltransferase	NA	NA	NA	NA	NA
AVG61699.1|1978703_1979522_+	regulatory protein RecX	NA	NA	NA	NA	NA
AVG61700.1|1979499_1979814_+	DUF1811 domain-containing protein	NA	NA	NA	NA	NA
AVG61701.1|1979828_1981346_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AVG61702.1|1981354_1982191_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61703.1|1982117_1982348_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61704.1|1982451_1983429_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVG61705.1|1983580_1984618_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AVG61706.1|1984919_1985462_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
AVG61707.1|1985752_1987489_+	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
AVG61708.1|1987497_1987590_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62617.1|1987679_1988774_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
AVG61709.1|1989066_1990356_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AVG61710.1|1990436_1990892_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AVG61711.1|1990897_1991848_+	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
AVG61712.1|1991944_1992391_+	transcriptional repressor	NA	NA	NA	NA	NA
AVG61713.1|2001084_2002287_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AVG61714.1|2002779_2003841_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
AVG61715.1|2004098_2005556_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG61716.1|2005542_2006271_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
AVG61717.1|2006406_2007549_+	epoxyqueuosine reductase	NA	NA	NA	NA	NA
AVG61718.1|2007553_2008024_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 141
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2017107	2017452	2873867		Streptococcus_phage(100.0%)	1	NA	NA
AVG61730.1|2017107_2017452_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 142
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2026924	2027665	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG61739.1|2026924_2027665_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 143
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2036546	2102128	2873867	transposase,bacteriocin,protease	Staphylococcus_phage(92.86%)	70	NA	NA
AVG61748.1|2036546_2037335_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	95.8	5.3e-140
AVG61749.1|2037347_2037887_-	hypothetical protein	NA	Q4ZCB9	Staphylococcus_virus	76.8	2.0e-61
AVG62618.1|2038715_2039621_+	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	99.7	3.6e-172
AVG61750.1|2039622_2040606_+	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.1	2.3e-185
AVG61751.1|2040847_2040991_+	gallidermin/nisin family lantibiotic	NA	NA	NA	NA	NA
AVG61752.1|2041092_2041284_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61753.1|2041727_2041871_+	gallidermin/nisin family lantibiotic	NA	A0A2H4PQH4	Staphylococcus_phage	80.9	5.3e-14
AVG61754.1|2041935_2044929_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4PQG8	Staphylococcus_phage	97.3	0.0e+00
AVG61755.1|2044921_2046166_+	lanthionine synthetase	NA	A0A2H4PQH9	Staphylococcus_phage	100.0	5.1e-238
AVG61756.1|2046181_2046700_+	enterotoxin	NA	A0A2H4PQG9	Staphylococcus_phage	100.0	2.0e-95
AVG61757.1|2046709_2048083_+	peptidase S8	NA	A0A2H4PQH1	Staphylococcus_phage	100.0	2.9e-258
AVG61758.1|2048105_2048798_+	lantibiotic ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	100.0	6.2e-124
AVG61759.1|2048794_2049556_+	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	A0A2H4PQH2	Staphylococcus_phage	100.0	4.4e-131
AVG61760.1|2049552_2050251_+	BsaG protein	NA	A0A2H4PQH0	Staphylococcus_phage	94.4	3.8e-113
AVG61761.1|2050724_2051291_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	100.0	3.3e-99
AVG61762.1|2051600_2051819_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61763.1|2052254_2052962_+|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	100.0	2.6e-130
AVG61764.1|2053086_2053809_+|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	99.6	2.4e-131
AVG61765.1|2053866_2054586_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	99.2	1.2e-130
AVG61766.1|2054706_2055426_+|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
AVG61767.1|2055374_2055482_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61768.1|2055583_2056300_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	100.0	1.1e-131
AVG61769.1|2056450_2057170_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	100.0	1.1e-131
AVG61770.1|2057234_2057369_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61771.1|2057349_2059089_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
AVG61772.1|2059081_2060281_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	100.0	8.5e-230
AVG61773.1|2061130_2065243_+	ATP-binding protein	NA	A0A2H4PQT3	Staphylococcus_phage	100.0	0.0e+00
AVG62619.1|2065780_2066140_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AVG61774.1|2066487_2066589_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61775.1|2067009_2067153_+	hypothetical protein	NA	A0A2H4PQU1	Staphylococcus_phage	100.0	6.4e-20
AVG61776.1|2067355_2067565_+|transposase	transposase	transposase	A0A2H4PQV6	Staphylococcus_phage	100.0	1.4e-31
AVG61777.1|2067756_2068140_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61778.1|2068150_2068327_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61779.1|2068328_2068514_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61780.1|2068627_2069269_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	93.2	2.6e-76
AVG61781.1|2069486_2070038_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.1	1.0e-20
AVG61782.1|2070135_2070480_-	DUF3969 domain-containing protein	NA	A0A2H4PQN6	Staphylococcus_phage	92.0	6.3e-53
AVG61783.1|2070520_2071147_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	82.7	7.1e-79
AVG61784.1|2071222_2072218_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	96.4	7.1e-73
AVG61785.1|2072298_2072949_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	2.7e-44
AVG62620.1|2073251_2073707_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	98.6	3.0e-79
AVG61786.1|2073865_2075344_+	2-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.0	2.0e-281
AVG61787.1|2075348_2076350_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.6	4.8e-186
AVG61788.1|2076346_2076604_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AVG61789.1|2076669_2077143_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	4.7e-83
AVG62621.1|2077147_2077894_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.4	7.1e-142
AVG61790.1|2078268_2078754_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
AVG61791.1|2078889_2080482_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
AVG61792.1|2080852_2082046_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
AVG61793.1|2082170_2083079_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	98.7	3.2e-136
AVG61794.1|2083290_2084124_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	98.6	9.6e-156
AVG61795.1|2086207_2086561_-	camphor resistance protein CrcB	NA	A0A2H4PQQ7	Staphylococcus_phage	99.1	1.0e-21
AVG61796.1|2086557_2086923_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AVG61797.1|2087178_2087481_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61798.1|2087740_2088454_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AVG61799.1|2088893_2089529_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG61800.1|2089824_2090268_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	85.0	3.0e-55
AVG61801.1|2090254_2090698_-	competence protein ComK	NA	NA	NA	NA	NA
AVG61802.1|2090810_2091281_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	3.3e-81
AVG61803.1|2091479_2091704_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61804.1|2091979_2092834_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AVG61805.1|2093128_2093524_-	protein ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	100.0	6.3e-73
AVG61806.1|2093541_2094834_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.3	1.9e-227
AVG61807.1|2094833_2095148_-	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	100.0	2.0e-53
AVG61808.1|2095670_2097173_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	100.0	2.3e-30
AVG62622.1|2097665_2098697_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	99.4	4.8e-197
AVG61809.1|2098703_2099336_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.5	1.7e-112
AVG61810.1|2099346_2100528_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
AVG61811.1|2100540_2101005_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	99.4	5.8e-70
AVG61812.1|2101126_2102128_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.7	9.0e-185
>prophage 144
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2105288	2119419	2873867	tRNA	Staphylococcus_phage(100.0%)	7	NA	NA
AVG61816.1|2105288_2105852_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
AVG61817.1|2105848_2106802_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AVG61818.1|2106911_2108093_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	100.0	5.6e-218
AVG61819.1|2108380_2110798_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.2	0.0e+00
AVG61820.1|2110819_2111131_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	100.0	1.6e-52
AVG61821.1|2111473_2118034_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	98.1	3.4e-304
AVG61822.1|2118150_2119419_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	100.0	4.1e-57
>prophage 145
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2131129	2136457	2873867		Staphylococcus_phage(50.0%)	3	NA	NA
AVG61833.1|2131129_2131987_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
AVG61834.1|2132015_2132612_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AVG61835.1|2132632_2136457_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 146
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2145362	2147069	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG61845.1|2145362_2147069_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	100.0	1.2e-274
>prophage 147
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2153686	2156317	2873867	tRNA	Cronobacter_phage(50.0%)	2	NA	NA
AVG61851.1|2153686_2154949_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
AVG61852.1|2155042_2156317_-	PDZ domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 148
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2160086	2164221	2873867		Staphylococcus_phage(50.0%)	4	NA	NA
AVG61857.1|2160086_2161691_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
AVG61858.1|2161677_2162838_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
AVG61859.1|2162951_2163398_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AVG61860.1|2163477_2164221_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.0	4.9e-18
>prophage 149
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2181761	2184959	2873867		Streptomyces_phage(100.0%)	1	NA	NA
AVG61879.1|2181761_2184959_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	1.3e-136
>prophage 150
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2189892	2193937	2873867	transposase	Staphylococcus_phage(50.0%)	2	NA	NA
AVG61884.1|2189892_2191650_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
AVG61885.1|2192290_2193937_+|transposase	IS5/IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	97.1	1.6e-287
>prophage 151
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2198506	2206670	2873867		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
AVG61890.1|2198506_2199211_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
AVG62627.1|2199210_2200872_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
AVG61891.1|2201370_2202858_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61892.1|2203151_2205782_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
AVG61893.1|2205797_2206670_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.0e-42
>prophage 152
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2210584	2221737	2873867	protease,tRNA	Brevibacillus_phage(20.0%)	13	NA	NA
AVG61898.1|2210584_2211505_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
AVG61899.1|2211597_2211720_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61900.1|2211917_2213855_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	5.9e-116
AVG61901.1|2214280_2215774_+	amino acid permease	NA	NA	NA	NA	NA
AVG62628.1|2216002_2216530_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
AVG61902.1|2216558_2216759_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVG61903.1|2216805_2217162_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVG61904.1|2217125_2217227_-	hypothetical protein	NA	NA	NA	NA	NA
AVG61905.1|2217303_2217912_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
AVG61906.1|2217930_2218860_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61907.1|2218864_2218975_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61908.1|2219022_2220324_+	trigger factor	NA	NA	NA	NA	NA
AVG61909.1|2220474_2221737_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 153
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2231304	2233935	2873867	tRNA	Catovirus(100.0%)	1	NA	NA
AVG61920.1|2231304_2233935_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	3.7e-153
>prophage 154
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2243802	2279182	2873867	protease,tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
AVG61936.1|2243802_2244807_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
AVG61937.1|2244808_2245834_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVG61938.1|2245856_2246996_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AVG61939.1|2247014_2247275_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AVG61940.1|2247549_2249829_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AVG61941.1|2250031_2252305_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.8	1.2e-62
AVG61942.1|2252326_2252845_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
AVG61943.1|2253272_2255462_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
AVG61944.1|2255473_2255926_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AVG61945.1|2255922_2256798_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
AVG61946.1|2257258_2258521_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AVG61947.1|2258536_2260303_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
AVG61948.1|2260635_2260764_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61949.1|2260763_2261537_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AVG61950.1|2261697_2262972_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.8e-105
AVG61951.1|2263056_2263479_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AVG61952.1|2263578_2263761_+	CsbD family protein	NA	NA	NA	NA	NA
AVG61953.1|2263800_2263947_+	hypothetical protein	NA	NA	NA	NA	NA
AVG61954.1|2264183_2265197_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AVG61955.1|2265508_2266651_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
AVG61956.1|2266651_2267770_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVG61957.1|2268231_2268900_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVG61958.1|2268901_2271379_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
AVG61959.1|2271721_2274352_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
AVG61960.1|2274414_2274675_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
AVG61961.1|2274678_2275107_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AVG61962.1|2275121_2275430_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AVG61963.1|2275714_2276353_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
AVG61964.1|2276355_2277279_+	U32 family peptidase	NA	NA	NA	NA	NA
AVG61965.1|2277290_2278559_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	31.7	4.0e-36
AVG61966.1|2278558_2279182_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 155
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2285854	2288241	2873867		Lactococcus_phage(50.0%)	2	NA	NA
AVG61974.1|2285854_2287075_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.3	5.0e-52
AVG61975.1|2287536_2288241_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	40.3	1.6e-47
>prophage 156
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2295510	2301674	2873867		Bacillus_phage(33.33%)	5	NA	NA
AVG61987.1|2295510_2295972_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
AVG61988.1|2296030_2298178_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.2e-32
AVG61989.1|2298234_2299209_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AVG61990.1|2299253_2299505_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AVG61991.1|2299850_2301674_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 157
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2305165	2308273	2873867		Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVG61996.1|2305165_2306998_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
AVG61997.1|2307133_2308273_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 158
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2314743	2315691	2873867		Rhizobium_phage(100.0%)	1	NA	NA
AVG62004.1|2314743_2315691_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 159
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2318744	2332472	2873867	tRNA	Klosneuvirus(25.0%)	13	NA	NA
AVG62009.1|2318744_2320136_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
AVG62010.1|2320470_2321094_+	transcriptional regulator	NA	NA	NA	NA	NA
AVG62011.1|2321104_2321923_+	phosphoenolpyruvate synthetase regulatory protein	NA	NA	NA	NA	NA
AVG62012.1|2321983_2323783_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	4.6e-54
AVG62013.1|2324006_2325113_+	RNA polymerase sigma factor SigA	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
AVG62014.1|2325243_2325921_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AVG62015.1|2325923_2327024_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	29.6	5.2e-08
AVG62016.1|2327137_2328484_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A1V0SIR5	Klosneuvirus	33.7	5.3e-55
AVG62017.1|2328493_2329384_+	endonuclease	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
AVG62018.1|2329509_2330295_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
AVG62019.1|2330336_2331200_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AVG62020.1|2331186_2331597_+	transcriptional repressor	NA	NA	NA	NA	NA
AVG62021.1|2331872_2332472_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 160
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2338645	2339269	2873867		Streptococcus_phage(100.0%)	1	NA	NA
AVG62029.1|2338645_2339269_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 161
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2344813	2347625	2873867		Prochlorococcus_phage(100.0%)	2	NA	NA
AVG62039.1|2344813_2346160_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	39.7	6.3e-64
AVG62040.1|2346152_2347625_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	41.3	6.2e-81
>prophage 162
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2355125	2361696	2873867		Indivirus(66.67%)	6	NA	NA
AVG62051.1|2355125_2356463_+	exodeoxyribonuclease 7 large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
AVG62052.1|2356455_2356686_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AVG62053.1|2356663_2357545_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	26.1	8.9e-11
AVG62054.1|2357976_2358429_+	arginine repressor	NA	NA	NA	NA	NA
AVG62055.1|2358444_2360124_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AVG62056.1|2360274_2361696_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	5.1e-40
>prophage 163
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2368525	2369932	2873867		Synechococcus_phage(100.0%)	1	NA	NA
AVG62064.1|2368525_2369932_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 164
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2374578	2376063	2873867		Cyanophage(100.0%)	1	NA	NA
AVG62070.1|2374578_2376063_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 165
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2379592	2437238	2873867	terminase,capsid,integrase,holin,tail,protease,head,portal	Staphylococcus_phage(61.97%)	79	2391003:2391027	2437035:2437059
AVG62075.1|2379592_2380501_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.5	3.4e-05
AVG62076.1|2380582_2381125_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AVG62077.1|2381229_2381679_+	transcriptional repressor	NA	NA	NA	NA	NA
AVG62078.1|2381727_2382615_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
AVG62079.1|2382692_2383199_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AVG62080.1|2383290_2384022_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
AVG62081.1|2384014_2384557_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
AVG62082.1|2384549_2385287_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AVG62083.1|2385419_2386145_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
AVG62084.1|2386125_2387877_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
AVG62085.1|2388121_2389051_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
AVG62086.1|2389043_2391071_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	97.2	3.4e-114
2391003:2391027	attL	CCATCACATTATGACGATATGTTTA	NA	NA	NA	NA
AVG62087.1|2391113_2392319_-|integrase	site-specific integrase	integrase	Q8SDS6	Staphylococcus_virus	100.0	5.9e-223
AVG62088.1|2392444_2393059_+	ATPase	NA	A7TW88	Staphylococcus_phage	100.0	7.9e-107
AVG62089.1|2393055_2393202_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
AVG62090.1|2393238_2393421_-	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
AVG62091.1|2393624_2393966_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
AVG62092.1|2393971_2394904_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
AVG62093.1|2394919_2395633_-	XRE family transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
AVG62094.1|2395595_2395769_+	transcriptional regulator	NA	NA	NA	NA	NA
AVG62095.1|2395765_2396029_+	XRE family transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
AVG62096.1|2396044_2396290_+	DUF2829 domain-containing protein	NA	Q8SDS1	Staphylococcus_virus	100.0	1.1e-40
AVG62097.1|2396258_2396624_-	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	97.5	1.7e-61
AVG62098.1|2396678_2396894_+	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
AVG62099.1|2396918_2397182_+	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	100.0	5.7e-46
AVG62100.1|2397194_2397356_+	DUF1270 domain-containing protein	NA	Q4ZCI2	Staphylococcus_virus	100.0	1.9e-20
AVG62101.1|2397434_2397758_+	TrmB family transcriptional regulator	NA	B7T0G4	Staphylococcus_virus	100.0	8.5e-52
AVG62102.1|2397772_2398135_+	hypothetical protein	NA	Q4ZCH9	Staphylococcus_virus	100.0	2.9e-56
AVG62103.1|2398131_2399298_+	DUF2800 domain-containing protein	NA	Q8SDR9	Staphylococcus_virus	100.0	7.0e-221
AVG62104.1|2399323_2399881_+	DUF2815 domain-containing protein	NA	A0A2I6PF05	Staphylococcus_phage	100.0	1.8e-97
AVG62632.1|2399949_2401902_+	DNA polymerase	NA	A0A2I6PF18	Staphylococcus_phage	100.0	0.0e+00
AVG62105.1|2401914_2402100_+	DUF3113 domain-containing protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
AVG62106.1|2402099_2402501_+	PVL family protein	NA	A0A2I6PF14	Staphylococcus_phage	100.0	1.2e-68
AVG62107.1|2402500_2402758_+	DUF3310 domain-containing protein	NA	Q8SDR4	Staphylococcus_virus	100.0	4.4e-43
AVG62108.1|2402760_2402961_+	hypothetical protein	NA	A0A2I6PF32	Staphylococcus_phage	100.0	1.3e-29
AVG62109.1|2402969_2403218_+	hypothetical protein	NA	Q8SDR2	Staphylococcus_virus	100.0	1.8e-41
AVG62110.1|2403231_2403438_+	hypothetical protein	NA	A0A0N9BAW9	Staphylococcus_phage	100.0	3.0e-34
AVG62111.1|2403440_2403842_+	hypothetical protein	NA	A0A0N7E0T5	Staphylococcus_phage	100.0	7.0e-72
AVG62112.1|2403838_2404186_+	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
AVG62113.1|2404182_2404491_+	hypothetical protein	NA	Q4ZBK6	Staphylococcus_phage	100.0	8.1e-52
AVG62114.1|2404483_2404720_+	hypothetical protein	NA	C8CH04	Staphylococcus_phage	100.0	1.1e-35
AVG62115.1|2404724_2405267_+	dUTP pyrophosphatase	NA	Q4ZD81	Staphylococcus_virus	100.0	1.5e-96
AVG62116.1|2405303_2405492_+	DUF1381 domain-containing protein	NA	Q4ZCG4	Staphylococcus_virus	100.0	1.6e-26
AVG62117.1|2405466_2405667_+	hypothetical protein	NA	A0A2I6PF22	Staphylococcus_phage	100.0	1.8e-28
AVG62118.1|2405654_2405822_+	transcriptional regulator	NA	A0A2I6PF16	Staphylococcus_phage	100.0	2.1e-22
AVG62119.1|2405889_2406090_+	DUF1514 domain-containing protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
AVG62120.1|2406141_2408589_+	hypothetical protein	NA	Q4ZCG0	Staphylococcus_virus	100.0	0.0e+00
AVG62121.1|2408691_2408796_-	hypothetical protein	NA	Q4ZCF8	Staphylococcus_virus	100.0	9.4e-13
AVG62122.1|2408929_2409220_+	VRR-NUC domain-containing protein	NA	A0A2I6PEN7	Staphylococcus_phage	100.0	6.5e-51
AVG62123.1|2409200_2410568_+	ATP-dependent helicase	NA	Q4ZCF6	Staphylococcus_virus	100.0	4.6e-264
AVG62124.1|2410580_2411018_+	transcriptional regulator	NA	A0A2K9VBV2	Staphylococcus_phage	99.3	7.9e-77
AVG62125.1|2411174_2411489_+	HNH endonuclease	NA	Q8SDQ2	Staphylococcus_virus	100.0	1.9e-56
AVG62126.1|2411610_2411916_+|terminase	phage terminase small subunit P27 family	terminase	A0A2I6PEQ6	Staphylococcus_phage	100.0	2.9e-49
AVG62127.1|2411905_2413597_+|terminase	terminase large subunit	terminase	Q4ZD20	Staphylococcus_virus	99.8	0.0e+00
AVG62128.1|2413601_2414840_+|portal	phage portal protein	portal	A0A2I6PF26	Staphylococcus_phage	100.0	1.2e-234
AVG62129.1|2414823_2415597_+|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	100.0	2.4e-137
AVG62633.1|2415608_2416772_+|capsid	phage major capsid protein	capsid	A0A2I6PEQ3	Staphylococcus_phage	100.0	1.2e-217
AVG62130.1|2416840_2417119_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
AVG62131.1|2417130_2417463_+	hypothetical protein	NA	A0A2I6PES3	Staphylococcus_phage	100.0	4.1e-57
AVG62132.1|2417459_2417861_+	hypothetical protein	NA	A0A2I6PF54	Staphylococcus_phage	100.0	8.1e-68
AVG62133.1|2417861_2418257_+	DUF3168 domain-containing protein	NA	A0A2I6PEQ4	Staphylococcus_phage	100.0	8.8e-67
AVG62134.1|2418291_2418933_+|tail	phage tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
AVG62135.1|2419024_2419480_+|tail	phage tail protein	tail	A0A2I6PF45	Staphylococcus_phage	100.0	1.3e-77
AVG62136.1|2419537_2419888_+	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
AVG62137.1|2419929_2420088_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
AVG62138.1|2420101_2426302_+|tail	phage tail tape measure protein	tail	Q8SDP3	Staphylococcus_virus	100.0	0.0e+00
AVG62139.1|2426301_2427126_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
AVG62140.1|2427134_2428718_+	peptidase	NA	Q8SDP1	Staphylococcus_virus	100.0	7.1e-309
AVG62141.1|2428717_2429008_+	hypothetical protein	NA	Q8SDP0	Staphylococcus_virus	100.0	2.1e-49
AVG62142.1|2429023_2430934_+	hypothetical protein	NA	A0A2I6PF35	Staphylococcus_phage	100.0	0.0e+00
AVG62143.1|2430933_2432400_+	hypothetical protein	NA	Q8SDN8	Staphylococcus_virus	100.0	3.4e-257
AVG62144.1|2432399_2432789_+	hypothetical protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
AVG62145.1|2432781_2432946_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
AVG62146.1|2432991_2433291_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
AVG62147.1|2433426_2433729_+|holin	phage holin	holin	B7T0L0	Staphylococcus_virus	100.0	4.1e-48
AVG62148.1|2433739_2435194_+	amidase	NA	Q8SDN4	Staphylococcus_virus	100.0	8.8e-290
AVG62149.1|2435391_2435574_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62150.1|2435809_2436646_+	hypothetical protein	NA	D2JLG6	Staphylococcus_phage	100.0	8.4e-152
AVG62151.1|2436890_2437238_+	hypothetical protein	NA	Q4ZCJ7	Staphylococcus_virus	100.0	3.0e-26
2437035:2437059	attR	CCATCACATTATGACGATATGTTTA	NA	NA	NA	NA
>prophage 166
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2441629	2444308	2873867		Bacillus_phage(50.0%)	3	NA	NA
AVG62158.1|2441629_2441878_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
AVG62159.1|2441985_2442939_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62160.1|2442928_2444308_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.6	2.9e-56
>prophage 167
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2453732	2459199	2873867		Bacillus_phage(25.0%)	8	NA	NA
AVG62172.1|2453732_2454005_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
AVG62173.1|2454194_2454509_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62174.1|2454435_2455008_+	heptaprenyl pyrophosphate synthase subunit A	NA	NA	NA	NA	NA
AVG62175.1|2455010_2455736_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
AVG62634.1|2455752_2456697_+	heptaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
AVG62176.1|2456788_2457238_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
AVG62177.1|2457446_2457647_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62178.1|2458032_2459199_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.1	7.6e-34
>prophage 168
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2462861	2463437	2873867		Bacillus_virus(100.0%)	1	NA	NA
AVG62182.1|2462861_2463437_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.7e-08
>prophage 169
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2466807	2474313	2873867	tRNA	unidentified_phage(25.0%)	5	NA	NA
AVG62186.1|2466807_2468010_+	CCA-adding enzyme	NA	H7BUW3	unidentified_phage	42.5	3.2e-35
AVG62187.1|2467996_2468968_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AVG62188.1|2468991_2471685_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
AVG62189.1|2472006_2473299_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
AVG62190.1|2473626_2474313_+	DnaD domain protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 170
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2478053	2478680	2873867		Bacillus_phage(100.0%)	1	NA	NA
AVG62194.1|2478053_2478680_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 171
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2488005	2488884	2873867		Bacillus_phage(100.0%)	1	NA	NA
AVG62204.1|2488005_2488884_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	6.2e-20
>prophage 172
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2524518	2533908	2873867	protease	Staphylococcus_phage(60.0%)	13	NA	NA
AVG62212.1|2524518_2525223_-	hypothetical protein	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
AVG62213.1|2525440_2525662_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AVG62214.1|2525673_2525925_+	scaffolding protein	NA	NA	NA	NA	NA
AVG62215.1|2525962_2527087_+	virulence factor C	NA	NA	NA	NA	NA
AVG62216.1|2527102_2527540_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
AVG62217.1|2527963_2528920_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
AVG62218.1|2529119_2529599_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
AVG62219.1|2529613_2530453_+	fatty acid-binding protein DegV	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
AVG62220.1|2530538_2531072_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AVG62221.1|2531064_2531493_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AVG62222.1|2531504_2532005_+	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AVG62223.1|2532004_2532226_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62224.1|2532417_2533908_+|protease	serine protease	protease	A0A0R6PIZ1	Moraxella_phage	30.5	2.3e-22
>prophage 173
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2537316	2539328	2873867		Bacillus_phage(50.0%)	2	NA	NA
AVG62230.1|2537316_2537976_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
AVG62231.1|2537972_2539328_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 174
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2545493	2546285	2873867		Halovirus(100.0%)	1	NA	NA
AVG62236.1|2545493_2546285_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 175
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2550764	2555795	2873867		Lactobacillus_phage(33.33%)	8	NA	NA
AVG62239.1|2550764_2551901_-	tellurite resistance protein TelA	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
AVG62240.1|2551932_2552562_-	5-bromo-4-chloroindolyl phosphate hydrolase	NA	NA	NA	NA	NA
AVG62241.1|2552580_2552850_-	acylphosphatase	NA	NA	NA	NA	NA
AVG62242.1|2553012_2553321_+	DUF1033 domain-containing protein	NA	NA	NA	NA	NA
AVG62243.1|2553268_2553457_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62244.1|2553491_2553692_+	cold-shock protein CspA	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
AVG62245.1|2553888_2554290_+	protein msa	NA	NA	NA	NA	NA
AVG62246.1|2554529_2555795_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
>prophage 176
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2563640	2565242	2873867		Klosneuvirus(100.0%)	1	NA	NA
AVG62254.1|2563640_2565242_-	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 177
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2570328	2573782	2873867		Indivirus(50.0%)	3	NA	NA
AVG62259.1|2570328_2571180_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
AVG62260.1|2571186_2571828_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AVG62261.1|2571967_2573782_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.1	5.1e-154
>prophage 178
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2577196	2577898	2873867		Tupanvirus(100.0%)	1	NA	NA
AVG62267.1|2577196_2577898_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	1.5e-13
>prophage 179
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2585414	2587769	2873867		Acinetobacter_phage(100.0%)	3	NA	NA
AVG62275.1|2585414_2586197_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	36.3	1.2e-27
AVG62276.1|2586198_2587197_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	35.3	3.8e-34
AVG62277.1|2587202_2587769_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 180
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2592087	2593350	2873867		Bacillus_phage(100.0%)	1	NA	NA
AVG62281.1|2592087_2593350_-	DNA repair protein	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 181
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2603009	2607403	2873867		Bacillus_phage(50.0%)	2	NA	NA
AVG62291.1|2603009_2605412_-	DNA topoisomerase 4 subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.8e-93
AVG62636.1|2605411_2607403_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 182
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2613339	2614986	2873867		Vibrio_phage(100.0%)	1	NA	NA
AVG62299.1|2613339_2614986_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 183
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2618655	2619777	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG62302.1|2618655_2619777_-	exonuclease sbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 184
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2623926	2629582	2873867		Phage_Wrath(25.0%)	7	NA	NA
AVG62309.1|2623926_2624550_+	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
AVG62310.1|2624929_2625793_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	4.1e-16
AVG62311.1|2625866_2625971_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62312.1|2625967_2626945_-	guanosine monophosphate reductase	NA	Q4ZCY7	Staphylococcus_virus	100.0	2.1e-186
AVG62313.1|2627101_2627371_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AVG62314.1|2627824_2627974_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVG62315.1|2628064_2629582_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 185
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2639718	2643994	2873867		Bacillus_phage(50.0%)	6	NA	NA
AVG62325.1|2639718_2640252_-	thermonuclease	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
AVG62326.1|2640390_2640579_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62327.1|2640691_2641294_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG62328.1|2641290_2642382_-	sensor histidine kinase	NA	NA	NA	NA	NA
AVG62329.1|2642385_2643117_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG62330.1|2643085_2643994_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	3.1e-22
>prophage 186
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2648542	2654967	2873867	head	Staphylococcus_phage(66.67%)	14	NA	NA
AVG62336.1|2648542_2648833_-	hypothetical protein	NA	S6B1L4	Thermus_phage	35.1	5.4e-05
AVG62337.1|2649260_2649398_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62338.1|2649394_2649661_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62339.1|2649780_2649903_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62340.1|2649937_2650186_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62341.1|2650306_2650891_-|head	phage head morphogenesis protein	head	Q4ZE35	Staphylococcus_virus	72.0	2.0e-30
AVG62342.1|2650936_2651188_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62343.1|2651188_2651362_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62344.1|2651316_2651421_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62345.1|2651932_2652118_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
AVG62346.1|2652545_2652656_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62347.1|2653356_2653563_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
AVG62348.1|2653856_2654081_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	71.0	4.3e-18
AVG62349.1|2654769_2654967_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 187
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2660036	2660513	2873867		Fowlpox_virus(100.0%)	1	NA	NA
AVG62354.1|2660036_2660513_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 188
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2666455	2672927	2873867		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
AVG62360.1|2666455_2667274_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
AVG62361.1|2667738_2668281_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
AVG62362.1|2668286_2670296_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.3	2.8e-60
AVG62363.1|2670308_2672927_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.8	2.9e-41
>prophage 189
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2682341	2683385	2873867		Bacillus_phage(100.0%)	1	NA	NA
AVG62373.1|2682341_2683385_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 190
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2687586	2693130	2873867		Bacillus_virus(33.33%)	4	NA	NA
AVG62379.1|2687586_2688873_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
AVG62380.1|2688872_2690138_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
AVG62381.1|2690168_2690882_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVG62639.1|2690886_2693130_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 191
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2698270	2710083	2873867	tRNA	Klosneuvirus(33.33%)	10	NA	NA
AVG62386.1|2698270_2699242_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
AVG62387.1|2699256_2700174_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AVG62388.1|2700342_2700693_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AVG62389.1|2701078_2703196_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
AVG62390.1|2703200_2703518_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62391.1|2703514_2703799_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
AVG62392.1|2703819_2704995_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AVG62393.1|2705015_2705483_-	ribosome maturation factor	NA	NA	NA	NA	NA
AVG62640.1|2705462_2705663_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62641.1|2705772_2710083_-	DNA polymerase III subunit alpha	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 192
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2714381	2715152	2873867		Flavobacterium_phage(100.0%)	1	NA	NA
AVG62397.1|2714381_2715152_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 193
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2719926	2733597	2873867	tRNA	Erwinia_phage(16.67%)	11	NA	NA
AVG62405.1|2719926_2721330_-	HslU--HslV peptidase ATPase subunit	NA	A0A1B2IDZ7	Erwinia_phage	25.6	4.9e-27
AVG62406.1|2721395_2721941_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AVG62407.1|2721937_2722834_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.5	3.6e-31
AVG62408.1|2723250_2724558_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AVG62409.1|2724713_2726789_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
AVG62642.1|2726962_2727703_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVG62410.1|2728007_2729252_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
AVG62411.1|2729279_2730398_-	cell wall hydrolase	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
AVG62412.1|2730624_2731533_-	succinyl-CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
AVG62413.1|2731554_2732721_-	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AVG62414.1|2732829_2733597_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 194
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2746981	2749039	2873867		Acanthamoeba_polyphaga_mimivirus(33.33%)	4	NA	NA
AVG62425.1|2746981_2747713_-	ribonuclease 3	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
AVG62426.1|2747828_2748062_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
AVG62427.1|2748083_2748182_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62428.1|2748304_2749039_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 195
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2759409	2761404	2873867		Moumouvirus(100.0%)	1	NA	NA
AVG62439.1|2759409_2761404_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 196
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2764551	2765487	2873867	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
AVG62443.1|2764551_2765487_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.9	1.2e-10
>prophage 197
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2770499	2772756	2873867		Methanothermobacter_phage(50.0%)	3	NA	NA
AVG62448.1|2770499_2771699_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
AVG62449.1|2771914_2772133_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVG62450.1|2772132_2772756_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.7	3.6e-22
>prophage 198
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2776070	2776682	2873867		Pandoravirus(100.0%)	1	NA	NA
AVG62454.1|2776070_2776682_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	6.2e-27
>prophage 199
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2780649	2785260	2873867		Halovirus(33.33%)	4	NA	NA
AVG62457.1|2780649_2781750_-	carbamoyl-phosphate synthase small chain	NA	R4TGJ8	Halovirus	36.7	5.6e-63
AVG62458.1|2781751_2783026_-	dihydroorotase	NA	NA	NA	NA	NA
AVG62459.1|2783043_2783925_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
AVG62460.1|2783952_2785260_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 200
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2789723	2792477	2873867	tRNA	Orpheovirus(100.0%)	1	NA	NA
AVG62465.1|2789723_2792477_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 201
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2812075	2812264	2873867		Staphylococcus_phage(100.0%)	1	NA	NA
AVG62483.1|2812075_2812264_-	DNA-binding protein	NA	A0A0K1LL29	Staphylococcus_phage	86.9	3.8e-20
>prophage 202
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2821234	2824316	2873867		Staphylococcus_phage(100.0%)	5	NA	NA
AVG62491.1|2821234_2821459_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
AVG62492.1|2821415_2821562_-	hypothetical protein	NA	NA	NA	NA	NA
AVG62493.1|2822234_2823194_+	alpha-hemolysin	NA	A0A2H4PQH7	Staphylococcus_phage	29.9	2.8e-34
AVG62494.1|2823670_2823904_+	hypothetical protein	NA	NA	NA	NA	NA
AVG62646.1|2824097_2824316_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	52.5	2.8e-06
>prophage 203
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2837365	2841923	2873867		Staphylococcus_phage(33.33%)	3	NA	NA
AVG62512.1|2837365_2837680_-	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
AVG62513.1|2837852_2840201_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.3	1.1e-15
AVG62514.1|2840210_2841923_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	8.9e-15
>prophage 204
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2846665	2847724	2873867	tRNA	Orpheovirus(100.0%)	1	NA	NA
AVG62520.1|2846665_2847724_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 205
CP026961	Staphylococcus aureus strain FDAARGOS_10 chromosome, complete genome	2873867	2857706	2872108	2873867	plate,tail,holin	Staphylococcus_phage(53.85%)	13	NA	NA
AVG62532.1|2857706_2858543_-	hypothetical protein	NA	D2JLG6	Staphylococcus_phage	100.0	8.4e-152
AVG62533.1|2859157_2860612_-	CHAP domain-containing protein	NA	Q4ZBP3	Staphylococcus_phage	100.0	4.0e-290
AVG62534.1|2860623_2860926_-|holin	phage holin	holin	A0A2I6PET6	Staphylococcus_phage	100.0	7.0e-48
AVG62535.1|2860981_2861377_-	hypothetical protein	NA	Q4ZBP5	Staphylococcus_phage	100.0	2.7e-68
AVG62536.1|2861382_2862555_-|tail	phage tail protein	tail	Q8SDT0	Staphylococcus_phage	100.0	2.9e-198
AVG62537.1|2862567_2864466_-	CHAP domain-containing protein	NA	A4ZFD3	Staphylococcus_virus	100.0	0.0e+00
AVG62538.1|2864602_2864902_-	DUF2951 domain-containing protein	NA	A4ZFD2	Staphylococcus_virus	100.0	1.3e-46
AVG62647.1|2864942_2865116_-	XkdX family protein	NA	B2ZZ00	Staphylococcus_phage	100.0	1.0e-27
AVG62539.1|2865125_2865503_-	DUF2977 domain-containing protein	NA	A0A2H4PQW4	Staphylococcus_phage	100.0	5.3e-61
AVG62540.1|2865502_2867326_-|plate	phage baseplate upper protein	plate	A4ZFC8	Staphylococcus_virus	99.8	0.0e+00
AVG62541.1|2867325_2869236_-	hypothetical protein	NA	Q4ZDL3	Staphylococcus_virus	99.8	0.0e+00
AVG62542.1|2869250_2871152_-	peptidase	NA	Q4ZDL5	Staphylococcus_virus	100.0	0.0e+00
AVG62543.1|2871160_2872108_-|tail	phage tail family protein	tail	A4ZFC4	Staphylococcus_virus	100.0	2.8e-183
