The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026964	Staphylococcus aureus strain FDAARGOS_2 chromosome, complete genome	2800003	5814	13635	2800003		Pandoravirus(16.67%)	10	NA	NA
AVG65350.1|5814_6966_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
AVG65351.1|6949_7543_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	43.5	1.2e-38
AVG65352.1|7893_8562_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AVG65353.1|8563_8983_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AVG65354.1|8986_9700_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AVG65355.1|9798_10383_+	hypothetical protein	NA	NA	NA	NA	NA
AVG65356.1|10662_11103_+	hypothetical protein	NA	NA	NA	NA	NA
AVG65357.1|11445_11919_+	DoxX family protein	NA	NA	NA	NA	NA
AVG65358.1|11893_12580_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG65359.1|12579_13635_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
>prophage 2
CP026964	Staphylococcus aureus strain FDAARGOS_2 chromosome, complete genome	2800003	1479823	1537614	2800003	terminase,tail,portal,protease,holin,head,integrase,capsid	Staphylococcus_phage(95.38%)	75	1483778:1483795	1530234:1530251
AVG66714.1|1479823_1480567_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG66715.1|1480741_1481026_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
AVG66716.1|1481101_1482718_+	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
AVG66717.1|1483419_1483632_+	pathogenicity island family protein	NA	Q4ZE86	Staphylococcus_phage	74.3	1.1e-23
AVG66718.1|1483628_1484219_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	94.7	1.2e-96
1483778:1483795	attL	ATATATACAAGAACAAAA	NA	NA	NA	NA
AVG68041.1|1484535_1484973_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66719.1|1485078_1485522_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVG66720.1|1486375_1487683_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
AVG66721.1|1487843_1488755_+	ferrichrome ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG66722.1|1488816_1489662_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVG66723.1|1490033_1491257_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AVG66724.1|1491692_1492745_+	bi-component leukocidin LukGH subunit H	NA	A0A2I6PDF3	Staphylococcus_phage	32.1	1.6e-35
AVG66725.1|1492766_1493783_+	bi-component leukocidin LukGH subunit G	NA	A0A2I6PER8	Staphylococcus_phage	29.3	2.3e-26
AVG66726.1|1494901_1495939_-|integrase	site-specific integrase	integrase	E9LT82	Staphylococcus_phage	100.0	2.6e-195
AVG66727.1|1496022_1496751_-	exotoxin	NA	A0EX09	Staphylococcus_phage	32.3	6.4e-23
AVG66728.1|1496774_1497503_-	exotoxin	NA	A0EX09	Staphylococcus_phage	34.9	2.3e-28
AVG66729.1|1497698_1498469_-	transcriptional regulator	NA	A0A1P8L6G7	Staphylococcus_phage	100.0	6.2e-141
AVG66730.1|1498627_1498852_+	DUF739 domain-containing protein	NA	A7TW90	Staphylococcus_phage	100.0	4.5e-36
AVG66731.1|1498869_1499130_+	transcriptional regulator	NA	A7TW91	Staphylococcus_phage	100.0	2.7e-40
AVG66732.1|1499153_1499693_-	hypothetical protein	NA	A7TW92	Staphylococcus_phage	100.0	1.7e-97
AVG66733.1|1500510_1500708_+	hypothetical protein	NA	A0A1W6JPV3	Staphylococcus_phage	100.0	1.2e-24
AVG66734.1|1500738_1500879_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
AVG66735.1|1500893_1501526_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
AVG66736.1|1501584_1501905_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
AVG66737.1|1501901_1502063_+	DUF1270 domain-containing protein	NA	A0A2I6PDF7	Staphylococcus_phage	100.0	1.9e-20
AVG66738.1|1502155_1502416_+	hypothetical protein	NA	A0A2I6PDH1	Staphylococcus_phage	100.0	2.6e-43
AVG66739.1|1502424_1502688_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
AVG68042.1|1502696_1504640_+	ATPase	NA	A0A2I6PDH3	Staphylococcus_phage	99.1	0.0e+00
AVG66740.1|1504641_1505562_+	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
AVG66741.1|1505642_1506260_+	MBL fold metallo-hydrolase	NA	A0A1W6JPL3	Staphylococcus_phage	98.1	1.3e-85
AVG66742.1|1506260_1506731_+	Single-stranded DNA-binding protein 1	NA	A0A1P8L6D9	Staphylococcus_phage	96.2	7.7e-78
AVG66743.1|1506760_1507654_+	DnaD domain protein	NA	A0A0E3TAG7	Staphylococcus_phage	97.6	1.6e-137
AVG66744.1|1507660_1507879_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	98.6	4.0e-37
AVG66745.1|1507887_1508292_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0H3U2W2	Staphylococcus_phage	91.0	6.9e-67
AVG66746.1|1508632_1508782_+	transcriptional regulator	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
AVG66747.1|1508940_1509591_+	hypothetical protein	NA	D2JLD8	Staphylococcus_phage	100.0	8.9e-117
AVG66748.1|1509590_1509791_+	hypothetical protein	NA	A0A2I6PDV9	Staphylococcus_phage	98.5	4.0e-28
AVG66749.1|1509694_1509907_-	hypothetical protein	NA	NA	NA	NA	NA
AVG66750.1|1509813_1510284_+	hypothetical protein	NA	D2JLE0	Staphylococcus_phage	99.3	1.7e-69
AVG66751.1|1510398_1510851_+	hypothetical protein	NA	D2JLE1	Staphylococcus_phage	100.0	1.4e-79
AVG68043.1|1510866_1511211_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	100.0	4.2e-65
AVG66752.1|1511339_1511807_+|terminase	phage terminase small subunit P27 family	terminase	D2JLE3	Staphylococcus_phage	100.0	1.1e-81
AVG66753.1|1511809_1513504_+|terminase	phage terminase large subunit	terminase	D2JLE4	Staphylococcus_phage	100.0	0.0e+00
AVG66754.1|1513478_1513718_+	hypothetical protein	NA	A7TWC1	Staphylococcus_phage	98.7	1.2e-34
AVG68044.1|1513783_1514974_+|portal	phage portal protein	portal	D2JLE6	Staphylococcus_phage	100.0	1.8e-224
AVG66755.1|1514966_1515551_+|head,protease	HK97 family phage prohead protease	head,protease	D2JLE7	Staphylococcus_phage	100.0	9.8e-107
AVG66756.1|1515638_1516886_+|capsid	phage major capsid protein	capsid	A7TWC4	Staphylococcus_phage	100.0	5.0e-209
AVG66757.1|1516921_1517080_+	hypothetical protein	NA	D2JLE9	Staphylococcus_phage	100.0	3.2e-20
AVG66758.1|1517088_1517421_+|head,tail	phage head-tail adapter protein	head,tail	D2JLF0	Staphylococcus_phage	100.0	2.1e-58
AVG66759.1|1517407_1517743_+|head,tail	head-tail adaptor protein	head,tail	A7TWC7	Staphylococcus_phage	100.0	1.1e-59
AVG66760.1|1517742_1518120_+	hypothetical protein	NA	D2JLF2	Staphylococcus_phage	100.0	1.1e-61
AVG66761.1|1518116_1518497_+	hypothetical protein	NA	D2JLF3	Staphylococcus_phage	99.2	2.2e-67
AVG66762.1|1518497_1519451_+|tail	phage tail protein	tail	A7TWD0	Staphylococcus_phage	100.0	6.2e-175
AVG66763.1|1519515_1519962_+	hypothetical protein	NA	D2JLF5	Staphylococcus_phage	100.0	5.4e-73
AVG66764.1|1520021_1520144_+	hypothetical protein	NA	D2JLF6	Staphylococcus_phage	100.0	6.9e-15
AVG66765.1|1520199_1524849_+|tail	phage tail tape measure protein	tail	A0A1V0E5H1	Staphylococcus_phage	94.7	0.0e+00
AVG66766.1|1524848_1526339_+|tail	phage tail protein	tail	R9QST9	Staphylococcus_phage	100.0	3.1e-298
AVG66767.1|1526354_1530137_+	hypothetical protein	NA	A0A1X9H096	Staphylococcus_phage	99.4	0.0e+00
AVG66768.1|1530129_1530282_+	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
1530234:1530251	attR	ATATATACAAGAACAAAA	NA	NA	NA	NA
AVG66769.1|1530327_1530615_+	hypothetical protein	NA	A0A1X9H0N7	Staphylococcus_phage	100.0	7.6e-44
AVG66770.1|1530670_1531045_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
AVG66771.1|1531417_1532191_+	enterotoxin	NA	A0A1X9H080	Staphylococcus_phage	100.0	1.1e-145
AVG68045.1|1532299_1532476_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
AVG66772.1|1532528_1532636_-	hypothetical protein	NA	NA	NA	NA	NA
AVG66773.1|1532687_1532942_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AVG66774.1|1532953_1533709_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	99.6	7.6e-152
AVG66775.1|1533899_1534391_+	staphylokinase	NA	A0A1W6JQ12	Staphylococcus_phage	99.4	4.7e-86
AVG66776.1|1534837_1534993_-	amidase	NA	NA	NA	NA	NA
AVG66777.1|1534919_1535174_+	amidase	NA	Q4ZCK0	Staphylococcus_virus	93.0	8.0e-13
AVG66778.1|1535080_1535377_+	peptidoglycan hydrolase	NA	A0A1P8L6B4	Staphylococcus_phage	95.9	1.6e-49
AVG66779.1|1535888_1536239_+	inhibitor	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
AVG66780.1|1536291_1536552_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
AVG66781.1|1536530_1536839_-	hypothetical protein	NA	M9NTD8	Staphylococcus_phage	100.0	3.2e-40
AVG66782.1|1536862_1537042_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	98.3	1.4e-24
AVG66783.1|1537413_1537614_-	hypothetical protein	NA	A0A1P8L6A7	Staphylococcus_phage	100.0	3.4e-27
>prophage 3
CP026964	Staphylococcus aureus strain FDAARGOS_2 chromosome, complete genome	2800003	1630929	1736795	2800003	protease,bacteriocin,transposase,tRNA	Staphylococcus_phage(93.22%)	104	NA	NA
AVG66868.1|1630929_1632072_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AVG66869.1|1632076_1632547_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AVG66870.1|1632705_1633305_+	glucosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
AVG66871.1|1633329_1633482_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66872.1|1633546_1633810_-	hypothetical protein	NA	NA	NA	NA	NA
AVG66873.1|1634087_1634483_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66874.1|1634678_1636064_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AVG66875.1|1636524_1637346_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AVG66876.1|1637508_1638621_+	histidine kinase	NA	NA	NA	NA	NA
AVG66877.1|1638642_1639266_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG66878.1|1639621_1640086_+	transcriptional regulator	NA	NA	NA	NA	NA
AVG66879.1|1640264_1641389_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
AVG66880.1|1641457_1641802_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
AVG66881.1|1642074_1642281_-	hypothetical protein	NA	NA	NA	NA	NA
AVG66882.1|1642294_1642393_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66883.1|1642683_1643880_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
AVG66884.1|1643869_1646806_+	DNA repair protein Rad50	NA	NA	NA	NA	NA
AVG66885.1|1646802_1647744_+	3'-5' exoribonuclease YhaM	NA	NA	NA	NA	NA
AVG66886.1|1647864_1648827_-	foldase	NA	NA	NA	NA	NA
AVG66887.1|1649031_1649589_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
AVG66888.1|1650137_1650344_-	hypothetical protein	NA	NA	NA	NA	NA
AVG66889.1|1650321_1650687_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
AVG66890.1|1650828_1651251_-	HIT family protein	NA	NA	NA	NA	NA
AVG66891.1|1651384_1652125_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	7.0e-25
AVG66892.1|1652117_1653341_+	multidrug ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AVG66893.1|1653464_1653968_-	signal transduction protein TRAP	NA	NA	NA	NA	NA
AVG66894.1|1654130_1654241_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66895.1|1654230_1655268_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AVG66896.1|1655325_1656249_+	ferrochelatase	NA	NA	NA	NA	NA
AVG66897.1|1656272_1657673_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
AVG66898.1|1657613_1657901_-	hypothetical protein	NA	NA	NA	NA	NA
AVG66899.1|1657994_1658549_+	serine hydrolase family protein	NA	NA	NA	NA	NA
AVG66900.1|1661005_1661794_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	95.8	5.3e-140
AVG66901.1|1661806_1662262_-	hypothetical protein	NA	Q4ZCB9	Staphylococcus_virus	76.2	6.3e-61
AVG66902.1|1663158_1664094_+	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
AVG66903.1|1664095_1665079_+	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.1	2.3e-185
AVG66904.1|1665320_1665464_+	gallidermin/nisin family lantibiotic	NA	NA	NA	NA	NA
AVG66905.1|1665565_1665757_-	hypothetical protein	NA	NA	NA	NA	NA
AVG66906.1|1666200_1666344_+	gallidermin/nisin family lantibiotic	NA	A0A2H4PQH4	Staphylococcus_phage	80.9	5.3e-14
AVG66907.1|1666408_1669402_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4PQG8	Staphylococcus_phage	97.0	0.0e+00
AVG66908.1|1669394_1670639_+	lanthionine synthetase	NA	A0A2H4PQH9	Staphylococcus_phage	100.0	5.1e-238
AVG66909.1|1670654_1671173_+	enterotoxin	NA	A0A2H4PQG9	Staphylococcus_phage	100.0	2.0e-95
AVG66910.1|1671182_1672556_+	peptidase S8	NA	A0A2H4PQH1	Staphylococcus_phage	100.0	2.9e-258
AVG66911.1|1672578_1673271_+	lantibiotic ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	100.0	6.2e-124
AVG66912.1|1673267_1674029_+	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	A0A2H4PQH2	Staphylococcus_phage	100.0	4.4e-131
AVG66913.1|1674025_1674724_+	BsaG protein	NA	A0A2H4PQH0	Staphylococcus_phage	94.4	3.8e-113
AVG66914.1|1675197_1675764_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	99.5	4.3e-99
AVG66915.1|1676073_1676292_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66916.1|1676727_1677435_+|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	99.6	7.7e-130
AVG66917.1|1677559_1678282_+|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	100.0	6.4e-132
AVG66918.1|1678339_1679059_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	99.6	3.2e-131
AVG66919.1|1679179_1679899_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	99.2	9.2e-131
AVG66920.1|1679963_1680098_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66921.1|1680078_1681818_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
AVG66922.1|1681810_1683010_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	99.5	1.0e-227
AVG66923.1|1689216_1689318_-	hypothetical protein	NA	NA	NA	NA	NA
AVG66924.1|1689738_1689882_+	hypothetical protein	NA	A0A2H4PQU1	Staphylococcus_phage	100.0	6.4e-20
AVG66925.1|1690084_1690294_+|transposase	transposase	transposase	A0A2H4PQV6	Staphylococcus_phage	100.0	1.4e-31
AVG66926.1|1690485_1690869_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66927.1|1690879_1691056_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66928.1|1691429_1691897_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	100.0	3.3e-65
AVG66929.1|1692184_1692757_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	89.7	3.3e-22
AVG66930.1|1692857_1693199_-	DUF3969 domain-containing protein	NA	A0A2H4PQN6	Staphylococcus_phage	92.0	8.1e-53
AVG66931.1|1693239_1693866_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	94.7	3.6e-91
AVG66932.1|1693939_1694935_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	4.2e-73
AVG66933.1|1695015_1695666_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	99.1	3.0e-56
AVG68051.1|1695968_1696424_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	97.3	5.7e-78
AVG66934.1|1696582_1698061_+	2-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.0	2.6e-281
AVG66935.1|1698065_1699067_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.9	2.8e-186
AVG66936.1|1699063_1699321_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AVG66937.1|1699386_1699860_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
AVG68052.1|1699864_1700611_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	99.2	2.2e-143
AVG66938.1|1700988_1702581_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
AVG66939.1|1702952_1704146_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
AVG66940.1|1704270_1705179_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.0	1.7e-137
AVG66941.1|1705390_1706224_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	100.0	5.4e-159
AVG66942.1|1706235_1706415_-	hypothetical protein	NA	NA	NA	NA	NA
AVG66943.1|1706606_1706960_-	camphor resistance protein CrcB	NA	A0A2H4PQQ7	Staphylococcus_phage	98.3	2.0e-22
AVG66944.1|1706956_1707322_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AVG66945.1|1707577_1707880_-	hypothetical protein	NA	NA	NA	NA	NA
AVG66946.1|1708139_1708853_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AVG66947.1|1710222_1710666_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
AVG66948.1|1710652_1711096_-	competence protein ComK	NA	NA	NA	NA	NA
AVG66949.1|1711208_1711679_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	99.4	1.0e-82
AVG66950.1|1711877_1712102_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66951.1|1712377_1713232_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AVG66952.1|1713318_1714611_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	3.2e-227
AVG66953.1|1714610_1714925_-	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	100.0	2.0e-53
AVG66954.1|1715447_1716950_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.5e-29
AVG66955.1|1717442_1718474_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	99.7	1.6e-197
AVG66956.1|1718480_1719113_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	6.4e-112
AVG66957.1|1719123_1720305_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	100.0	1.7e-227
AVG66958.1|1720317_1720782_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
AVG66959.1|1720903_1721905_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.7	9.0e-185
AVG68053.1|1721813_1722005_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66960.1|1722016_1722136_+	hypothetical protein	NA	NA	NA	NA	NA
AVG66961.1|1722138_1722966_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVG66962.1|1723539_1723941_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVG66963.1|1724060_1724624_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
AVG66964.1|1724620_1725574_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AVG66965.1|1725683_1726865_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	6.2e-217
AVG66966.1|1727152_1729576_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.7	0.0e+00
AVG66967.1|1729597_1729909_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	100.0	1.6e-52
AVG66968.1|1730234_1736795_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	96.8	5.9e-301
>prophage 4
CP026964	Staphylococcus aureus strain FDAARGOS_2 chromosome, complete genome	2800003	1860467	1869510	2800003	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AVG67082.1|1860467_1861472_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
AVG67083.1|1861473_1862499_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVG67084.1|1862521_1863661_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AVG67085.1|1863679_1863940_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AVG67086.1|1864214_1866494_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AVG67087.1|1866696_1868970_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	6.8e-63
AVG67088.1|1868991_1869510_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
>prophage 5
CP026964	Staphylococcus aureus strain FDAARGOS_2 chromosome, complete genome	2800003	2482450	2490923	2800003		Synechococcus_phage(33.33%)	9	NA	NA
AVG67660.1|2482450_2483017_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	1.0e-28
AVG67661.1|2483019_2484048_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	1.3e-61
AVG67662.1|2484040_2485525_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
AVG67663.1|2485503_2487693_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	1.0e-140
AVG67664.1|2487685_2488357_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVG67665.1|2488358_2488622_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVG67666.1|2488621_2489326_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
AVG67667.1|2489329_2490454_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVG67668.1|2490440_2490923_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
>prophage 6
CP026964	Staphylococcus aureus strain FDAARGOS_2 chromosome, complete genome	2800003	2509777	2528810	2800003	bacteriocin,protease,holin	Staphylococcus_phage(33.33%)	23	NA	NA
AVG67684.1|2509777_2510779_+|protease	serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	32.3	6.2e-16
AVG67685.1|2510860_2512042_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
AVG67686.1|2512079_2512409_+	staphostatin B	NA	NA	NA	NA	NA
AVG67687.1|2512646_2513468_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AVG67688.1|2513460_2514264_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVG67689.1|2514250_2515924_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVG67690.1|2515910_2517122_-	isochorismate synthase	NA	NA	NA	NA	NA
AVG67691.1|2517198_2517303_-	hypothetical protein	NA	NA	NA	NA	NA
AVG67692.1|2517453_2518392_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVG67693.1|2518442_2518994_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVG67694.1|2519083_2519374_+	NINE protein	NA	A0A060AN66	Enterococcus_phage	39.2	4.4e-07
AVG67695.1|2519437_2519569_+	hypothetical protein	NA	NA	NA	NA	NA
AVG67696.1|2519614_2520574_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG67697.1|2521061_2521418_+	DoxX family protein	NA	NA	NA	NA	NA
AVG67698.1|2521506_2522988_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AVG67699.1|2522993_2523281_-	hypothetical protein	NA	NA	NA	NA	NA
AVG67700.1|2523621_2523912_+	hypothetical protein	NA	NA	NA	NA	NA
AVG67701.1|2523999_2524641_-|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	33.7	2.2e-19
AVG67702.1|2524637_2524958_-	hypothetical protein	NA	NA	NA	NA	NA
AVG68078.1|2526967_2527240_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AVG67703.1|2527249_2527351_-	hypothetical protein	NA	NA	NA	NA	NA
AVG68079.1|2527889_2527967_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AVG67704.1|2528207_2528810_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 7
CP026964	Staphylococcus aureus strain FDAARGOS_2 chromosome, complete genome	2800003	2534775	2584740	2800003	tail,terminase,portal,protease,holin,head,integrase,capsid	Staphylococcus_phage(83.33%)	66	2537115:2537141	2581869:2581895
AVG67711.1|2534775_2537100_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	27.4	2.8e-11
2537115:2537141	attL	TATCATTATGACACATTAACACCTAAT	NA	NA	NA	NA
AVG67712.1|2537660_2539115_-	CHAP domain-containing protein	NA	I1W626	Staphylococcus_phage	98.8	1.2e-286
AVG67713.1|2539125_2539428_-|holin	phage holin	holin	B7T0L0	Staphylococcus_virus	100.0	4.1e-48
AVG67714.1|2539563_2539863_-	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
AVG67715.1|2539908_2540073_-	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
AVG67716.1|2540065_2540455_-	hypothetical protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
AVG67717.1|2540454_2541921_-	DUF2479 domain-containing protein	NA	A0A2I6PDE3	Staphylococcus_phage	98.2	9.3e-271
AVG67718.1|2541920_2543831_-	hypothetical protein	NA	A0A2K9VBU3	Staphylococcus_phage	100.0	0.0e+00
AVG67719.1|2543846_2544137_-	hypothetical protein	NA	A0A2I6PF46	Staphylococcus_phage	100.0	2.1e-49
AVG67720.1|2544136_2545720_-	peptidase	NA	Q4ZD01	Staphylococcus_virus	98.7	1.3e-305
AVG67721.1|2545728_2546553_-|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
AVG67722.1|2546552_2552753_-|tail	phage tail tape measure protein	tail	A0A2K9VBQ5	Staphylococcus_phage	99.7	0.0e+00
AVG67723.1|2552766_2552925_-	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
AVG67724.1|2552966_2553317_-	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
AVG67725.1|2553374_2553830_-|tail	phage tail protein	tail	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
AVG67726.1|2553921_2554563_-|tail	phage tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
AVG67727.1|2554597_2554993_-	DUF3168 domain-containing protein	NA	A0A2I6PEQ4	Staphylococcus_phage	100.0	8.8e-67
AVG67728.1|2554993_2555395_-	hypothetical protein	NA	A0A2I6PF54	Staphylococcus_phage	100.0	8.1e-68
AVG67729.1|2555391_2555724_-	hypothetical protein	NA	A0A2I6PES3	Staphylococcus_phage	100.0	4.1e-57
AVG67730.1|2555735_2556014_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
AVG67731.1|2556082_2557246_-|capsid	phage major capsid protein	capsid	A0A2I6PEQ3	Staphylococcus_phage	100.0	1.2e-217
AVG67732.1|2557257_2558031_-|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	100.0	2.4e-137
AVG67733.1|2558014_2559253_-|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	99.8	1.2e-234
AVG67734.1|2559257_2560949_-|terminase	terminase large subunit	terminase	A0A2I6PE99	Staphylococcus_phage	99.6	0.0e+00
AVG67735.1|2560938_2561244_-|terminase	phage terminase small subunit P27 family	terminase	U5U414	Staphylococcus_phage	100.0	2.9e-49
AVG67736.1|2561369_2561690_-	HNH endonuclease	NA	A0A2K9VBV6	Staphylococcus_phage	86.8	4.6e-50
AVG67737.1|2561850_2562288_-	transcriptional regulator	NA	Q4ZCF5	Staphylococcus_virus	99.3	3.6e-77
AVG67738.1|2562300_2563677_-	ATP-dependent helicase	NA	A0A2I6PE95	Staphylococcus_phage	99.3	7.4e-262
AVG67739.1|2563657_2563948_-	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
AVG67740.1|2564081_2564186_+	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	2.7e-12
AVG67741.1|2564288_2566736_-	hypothetical protein	NA	A0A2I6PEP4	Staphylococcus_phage	99.0	0.0e+00
AVG67742.1|2566790_2566997_+	hypothetical protein	NA	A0A1X9IGZ9	Staphylococcus_phage	100.0	7.6e-30
AVG67743.1|2567023_2567224_-	DUF1514 domain-containing protein	NA	A0A2I6PEP5	Staphylococcus_phage	100.0	4.9e-26
AVG67744.1|2567291_2567444_-	transcriptional regulator	NA	A0A2I6PEM5	Staphylococcus_phage	100.0	2.0e-19
AVG67745.1|2567491_2568016_-	hypothetical protein	NA	A0A0K1LKF9	Staphylococcus_phage	88.5	4.7e-84
AVG67746.1|2568015_2568210_-	DUF1381 domain-containing protein	NA	A1KX86	Staphylococcus_virus	84.4	7.9e-21
AVG67747.1|2568226_2568400_-	hypothetical protein	NA	A0A2I6PEA8	Staphylococcus_phage	100.0	3.6e-25
AVG67748.1|2568436_2568973_-	dUTPase	NA	A0A1P8L6E0	Staphylococcus_phage	99.4	1.4e-94
AVG67749.1|2568965_2569214_-	DUF1024 domain-containing protein	NA	C8CH04	Staphylococcus_phage	96.3	5.9e-37
AVG67750.1|2569206_2569515_-	hypothetical protein	NA	Q4ZBK6	Staphylococcus_phage	97.1	9.9e-50
AVG67751.1|2569511_2569859_-	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
AVG67752.1|2569855_2570260_-	hypothetical protein	NA	A0A0E3T8H9	Staphylococcus_phage	100.0	4.2e-72
AVG67753.1|2570262_2570469_-	hypothetical protein	NA	A0A2K9VBT9	Staphylococcus_phage	100.0	3.0e-34
AVG67754.1|2570482_2570731_-	hypothetical protein	NA	Q8SDR2	Staphylococcus_virus	93.9	1.8e-38
AVG67755.1|2570730_2570985_-	DUF3310 domain-containing protein	NA	A0A059T7J9	Staphylococcus_phage	100.0	2.8e-42
AVG67756.1|2570984_2571386_-	PVL family protein	NA	A0A2I6PEL5	Staphylococcus_phage	100.0	1.2e-68
AVG67757.1|2571385_2571571_-	DUF3113 domain-containing protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
AVG68080.1|2571583_2573536_-	DNA polymerase	NA	B7T0G8	Staphylococcus_virus	98.9	0.0e+00
AVG67758.1|2573604_2574162_-	DUF2815 domain-containing protein	NA	A0A2K9VBT2	Staphylococcus_phage	95.7	1.3e-92
AVG67759.1|2574187_2575354_-	DUF2800 domain-containing protein	NA	A0A0K1LKE3	Staphylococcus_phage	99.5	4.5e-220
AVG67760.1|2575350_2575713_-	hypothetical protein	NA	A0A0K1LKE9	Staphylococcus_phage	95.8	1.7e-53
AVG67761.1|2575726_2575987_-	DUF1108 domain-containing protein	NA	A0EWW8	Staphylococcus_phage	94.2	8.4e-42
AVG67762.1|2576026_2576287_-	hypothetical protein	NA	A0A0H3U2W4	Staphylococcus_phage	98.8	1.3e-39
AVG67763.1|2576379_2576541_-	DUF1270 domain-containing protein	NA	A0A059T7J6	Staphylococcus_phage	94.3	3.6e-19
AVG67764.1|2576552_2576816_-	helix-turn-helix domain-containing protein	NA	A0A2I6PEL8	Staphylococcus_phage	100.0	2.5e-46
AVG67765.1|2576840_2577056_-	hypothetical protein	NA	A0A2I6PEK7	Staphylococcus_phage	100.0	1.0e-32
AVG67766.1|2577102_2577342_+	hypothetical protein	NA	A0A2I6PE22	Staphylococcus_phage	100.0	6.7e-38
AVG67767.1|2577598_2577790_-	XRE family transcriptional regulator	NA	A0A2I6PEL6	Staphylococcus_phage	100.0	2.3e-28
AVG67768.1|2577950_2578280_+	XRE family transcriptional regulator	NA	A0A2I6PEN2	Staphylococcus_phage	100.0	3.2e-54
AVG67769.1|2578292_2578754_+	toxin	NA	A0A2I6PEK4	Staphylococcus_phage	98.0	4.9e-85
AVG67770.1|2578771_2579206_+	hypothetical protein	NA	A0A2I6PEM0	Staphylococcus_phage	93.1	7.5e-19
AVG67771.1|2579234_2579630_+	hypothetical protein	NA	I1W601	Staphylococcus_phage	99.2	3.2e-69
AVG67772.1|2579828_2580452_-	hypothetical protein	NA	B7T0F3	Staphylococcus_virus	99.5	1.3e-104
AVG67773.1|2580578_2581784_+|integrase	site-specific integrase	integrase	B7T0F2	Staphylococcus_virus	100.0	4.2e-221
AVG67774.1|2582072_2582876_-	hypothetical protein	NA	S5MAL1	Bacillus_phage	41.0	4.2e-31
2581869:2581895	attR	TATCATTATGACACATTAACACCTAAT	NA	NA	NA	NA
AVG67775.1|2583177_2584740_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
>prophage 8
CP026964	Staphylococcus aureus strain FDAARGOS_2 chromosome, complete genome	2800003	2779027	2793758	2800003		uncultured_Caudovirales_phage(50.0%)	18	NA	NA
AVG67965.1|2779027_2779789_-	iron ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
AVG67966.1|2779785_2780742_-	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
AVG68085.1|2780728_2781700_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
AVG67967.1|2781738_2781894_-	hypothetical protein	NA	NA	NA	NA	NA
AVG67968.1|2782170_2782275_-	hypothetical protein	NA	NA	NA	NA	NA
AVG67969.1|2782407_2783379_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AVG67970.1|2783496_2785602_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AVG67971.1|2785564_2785963_-	protein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AVG67972.1|2786112_2786379_-	ribonucleoside-diphosphate reductase	NA	NA	NA	NA	NA
AVG67973.1|2786763_2787630_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVG67974.1|2787649_2788150_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AVG67975.1|2788179_2788425_+	hypothetical protein	NA	NA	NA	NA	NA
AVG67976.1|2788490_2789996_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AVG67977.1|2790073_2790175_-	hypothetical protein	NA	NA	NA	NA	NA
AVG67978.1|2790264_2791182_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.4	2.8e-07
AVG67979.1|2791594_2791690_-	hypothetical protein	NA	NA	NA	NA	NA
AVG67980.1|2791862_2792405_-	5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AVG67981.1|2792699_2793758_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	1.8e-21
