The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP011398	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3039878	125863	132390	3039878	tail	Listeria_phage(33.33%)	10	NA	NA
AKG87118.1|125863_126316_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
AKG87119.1|126321_126657_-	XRE family transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
AKG87120.1|126873_127302_+	hypothetical protein	NA	NA	NA	NA	NA
AKG87121.1|127313_127730_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
AKG87122.1|128009_128399_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
AKG87123.1|128411_128924_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
AKG87124.1|128971_129274_+	segregation and condensation protein B	NA	NA	NA	NA	NA
AKG89883.2|129315_129720_+	phenylalanine racemase	NA	NA	NA	NA	NA
AKG87125.1|129706_131575_+	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
AKG87126.1|131571_132390_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
CP011398	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3039878	1128647	1136070	3039878		Hokovirus(33.33%)	8	NA	NA
AKG88046.1|1128647_1129031_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
AKG88047.1|1129052_1130036_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
AKG88048.1|1130050_1131064_+	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
AKG88049.1|1131272_1132763_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
AKG88050.1|1132774_1133599_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.2	1.3e-67
AKG88051.1|1133611_1133920_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AKG88052.1|1133980_1134385_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
AKG88053.2|1134513_1136070_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	6.0e-18
>prophage 3
CP011398	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3039878	1231891	1298275	3039878	tail,portal,holin,head,capsid,terminase,integrase,tRNA	Listeria_phage(83.33%)	70	1257640:1257663	1299793:1299816
AKG88162.1|1231891_1232944_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
AKG88163.1|1232943_1235352_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AKG88164.1|1235512_1236214_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
AKG88165.1|1236227_1239638_+	ABC transporter permease	NA	NA	NA	NA	NA
AKG88166.1|1239735_1240188_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AKG88167.1|1240203_1243404_+	hypothetical protein	NA	NA	NA	NA	NA
AKG88168.1|1243507_1244182_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	3.4e-50
AKG88169.2|1244219_1245146_-	ribonuclease HIII	NA	NA	NA	NA	NA
AKG88170.2|1245299_1245563_+	cell division protein ZapA	NA	NA	NA	NA	NA
AKG88171.1|1245562_1246105_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AKG88172.1|1246196_1247909_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.5	1.9e-17
AKG88173.1|1247931_1250289_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
AKG88174.1|1250369_1250681_+	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
AKG88175.1|1250756_1252568_+	UvrABC system protein C	NA	NA	NA	NA	NA
AKG88176.1|1252748_1253963_+	aspartate kinase	NA	NA	NA	NA	NA
AKG88177.2|1254018_1254513_-	DUF2507 domain-containing protein	NA	NA	NA	NA	NA
AKG88178.1|1254660_1255461_+	glutamate racemase	NA	NA	NA	NA	NA
AKG88179.1|1255473_1256220_+	ribonuclease PH	NA	NA	NA	NA	NA
AKG88180.1|1256222_1256834_+	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	28.0	8.7e-05
AKG88181.1|1256870_1257395_+	metallophosphoesterase	NA	NA	NA	NA	NA
1257640:1257663	attL	TGAATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
AKG88182.1|1257680_1258835_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	97.7	2.8e-214
AKG88183.1|1258980_1259637_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
AKG89913.2|1259688_1260141_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	96.7	1.7e-82
AKG88184.1|1260157_1260481_-	XRE family transcriptional regulator	NA	Q8W5Y0	Listeria_phage	72.0	1.2e-37
AKG88185.1|1260941_1261259_-	hypothetical protein	NA	NA	NA	NA	NA
AKG88186.1|1261324_1261528_+	XRE family transcriptional regulator	NA	A0A059T5F8	Listeria_phage	100.0	3.1e-28
AKG88187.1|1261529_1261772_+	hypothetical protein	NA	A8ATD2	Listeria_phage	100.0	1.4e-43
AKG88188.1|1261774_1261960_+	hypothetical protein	NA	A0A059T7Z3	Listeria_phage	98.4	4.4e-29
AKG88189.1|1262483_1263242_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	98.3	3.3e-131
AKG88191.1|1263412_1264126_+	pentapeptide repeat-containing protein	NA	A8ATE4	Listeria_phage	89.0	1.9e-35
AKG88193.1|1264678_1265158_+	hypothetical protein	NA	NA	NA	NA	NA
AKG88194.1|1265158_1265788_+	hypothetical protein	NA	A0A191KBJ8	Streptococcus_virus	58.4	1.1e-66
AKG88195.1|1265806_1266040_+	hypothetical protein	NA	NA	NA	NA	NA
AKG88196.1|1266036_1266267_+	hypothetical protein	NA	NA	NA	NA	NA
AKG88197.1|1266256_1266523_+	hypothetical protein	NA	NA	NA	NA	NA
AKG88198.1|1267026_1267410_+	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
AKG88199.1|1267411_1267891_+	hypothetical protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
AKG88200.1|1267910_1268600_+	DNA-binding protein	NA	R4IDY8	Listeria_phage	98.3	4.8e-129
AKG89914.2|1268663_1269920_+	helicase	NA	R4IBK4	Listeria_phage	97.0	9.5e-224
AKG88201.1|1269942_1270425_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	100.0	4.9e-88
AKG88202.1|1270447_1272721_+	DNA primase	NA	A8ATF3	Listeria_phage	94.7	0.0e+00
AKG88203.1|1273013_1273334_+	VRR-NUC domain-containing protein	NA	W0G8N0	Listeria_phage	95.3	5.8e-53
AKG88204.1|1273330_1273600_+	hypothetical protein	NA	W0GBM0	Listeria_phage	73.6	5.3e-15
AKG89915.1|1273710_1274244_+	DUF3310 domain-containing protein	NA	A0A059T7T5	Listeria_phage	82.5	1.1e-80
AKG88205.1|1274240_1274510_+	hypothetical protein	NA	NA	NA	NA	NA
AKG88206.1|1274754_1274982_+	hypothetical protein	NA	NA	NA	NA	NA
AKG88207.1|1274994_1275420_+	hypothetical protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
AKG88208.1|1275517_1276261_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AKG88209.1|1276621_1276936_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	99.0	3.8e-57
AKG88210.1|1276984_1277341_+	hypothetical protein	NA	A0A059T7Y1	Listeria_phage	97.0	4.5e-46
AWG43509.1|1277337_1278981_+|terminase	terminase	terminase	A0A059T7Q8	Listeria_phage	98.2	0.0e+00
AWG43510.1|1278992_1280123_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	93.1	1.7e-203
AKG88211.1|1280119_1280917_+	peptidase	NA	A0A059T5F2	Listeria_phage	99.6	1.1e-143
AKG88212.1|1280943_1282095_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	100.0	6.3e-214
AKG88213.1|1282281_1282581_+	hypothetical protein	NA	A0A059T7R0	Listeria_phage	100.0	5.3e-48
AKG88214.1|1282564_1282930_+|head,tail	phage head-tail adapter protein	head,tail	A0A059T6F2	Listeria_phage	100.0	2.9e-64
AKG88215.1|1282926_1283328_+	hypothetical protein	NA	A0A059T5F3	Listeria_phage	100.0	2.1e-68
AKG88216.1|1283324_1283708_+	DUF3168 domain-containing protein	NA	A0A059T681	Listeria_phage	98.4	1.1e-66
AKG88217.1|1283728_1284316_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	98.5	2.9e-106
AKG88218.1|1284386_1284719_+	hypothetical protein	NA	A0A059T7R2	Listeria_phage	96.4	1.5e-51
AWG43511.1|1284934_1289851_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	96.9	0.0e+00
AKG88219.1|1291510_1293805_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	99.2	0.0e+00
AKG88220.1|1293794_1294886_+	carbohydrate-binding protein CenC	NA	A0A059T7R4	Listeria_phage	91.8	1.7e-189
AKG88221.1|1294936_1295242_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
AKG88222.1|1295241_1295523_+|holin	phage holin	holin	A8ATW3	Listeria_phage	100.0	3.0e-45
AKG88223.1|1295522_1296230_+	alkaline phosphatase	NA	A8ATW4	Listeria_phage	97.9	1.0e-129
AKG88224.1|1296377_1297079_+	DUF3800 domain-containing protein	NA	R4IBV1	Listeria_phage	97.8	6.4e-129
AKG88225.1|1297557_1297791_+	hypothetical protein	NA	A8ATX0	Listeria_phage	94.8	2.3e-35
AKG88226.1|1297787_1297979_+	hypothetical protein	NA	A8ATC6	Listeria_phage	98.4	1.7e-28
AWG43512.1|1298173_1298275_-|integrase	integrase	integrase	A0A059T688	Listeria_phage	66.7	2.4e-05
1299793:1299816	attR	TGAATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
>prophage 4
CP011398	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3039878	1320816	1372862	3039878	protease,tail,holin,capsid,head	Listeria_phage(91.89%)	78	NA	NA
AKG88250.1|1320816_1322064_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	7.2e-107
AKG88251.1|1322047_1322878_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
AKG88252.1|1323024_1324164_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
AKG88253.1|1324243_1324639_-	XRE family transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
AKG88254.1|1324955_1326371_-	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	47.1	3.0e-117
AKG88255.1|1326460_1326853_-	hypothetical protein	NA	A8ATJ7	Listeria_phage	94.6	2.6e-55
AKG88256.1|1326899_1327319_-	ImmA/IrrE family metallo-endopeptidase	NA	A8ATJ8	Listeria_phage	98.6	3.4e-77
AKG88257.1|1327335_1327764_-	XRE family transcriptional regulator	NA	A8ATJ9	Listeria_phage	99.3	2.0e-72
AKG88258.1|1327922_1328108_+	XRE family transcriptional regulator	NA	A8ATK0	Listeria_phage	100.0	5.8e-29
AKG88259.1|1328184_1328709_+	hypothetical protein	NA	A8ATK1	Listeria_phage	90.8	6.6e-86
AKG88260.1|1329187_1329472_+	hypothetical protein	NA	A8ATK4	Listeria_phage	54.2	9.2e-26
AKG88261.1|1329649_1329877_+	hypothetical protein	NA	A8ATK5	Listeria_phage	98.7	5.2e-32
AKG88262.1|1329894_1330236_+	hypothetical protein	NA	A8ATK6	Listeria_phage	51.3	6.7e-23
AKG88263.1|1330222_1332166_+	hypothetical protein	NA	A8ATK7	Listeria_phage	98.3	0.0e+00
AKG88264.1|1332169_1332901_+	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	61.4	6.0e-77
AKG88265.1|1332900_1333596_+	MBL fold metallo-hydrolase	NA	A8ATK9	Listeria_phage	97.4	4.3e-125
AKG88266.1|1333607_1334525_+	DnaD domain protein	NA	A8ATL0	Listeria_phage	100.0	2.2e-169
AKG88267.1|1334448_1335264_+	DnaC	NA	A8ATL1	Listeria_phage	99.3	4.1e-143
AKG88268.1|1335260_1335461_+	hypothetical protein	NA	A8ATL2	Listeria_phage	89.4	4.0e-28
AKG89916.1|1335447_1335669_+	hypothetical protein	NA	A8ATL3	Listeria_phage	85.3	1.2e-28
AKG88269.1|1335625_1335865_+	hypothetical protein	NA	A8ATL4	Listeria_phage	98.6	3.6e-31
AKG88270.1|1335845_1336283_+	RusA family crossover junction endodeoxyribonuclease	NA	A8ATL5	Listeria_phage	91.0	8.5e-71
AKG88271.1|1336302_1336923_+	hypothetical protein	NA	A8ATL6	Listeria_phage	98.1	6.1e-107
AKG88272.1|1336963_1337344_+	hypothetical protein	NA	A8ATL7	Listeria_phage	95.2	1.6e-65
AKG88273.1|1337496_1337919_+	hypothetical protein	NA	A8ATL9	Listeria_phage	88.6	6.1e-50
AKG88274.1|1337915_1339277_+	hypothetical protein	NA	A8ATM0	Listeria_phage	94.7	2.4e-249
AKG88275.1|1339293_1339671_+	hypothetical protein	NA	NA	NA	NA	NA
AKG88276.1|1339667_1339922_+	hypothetical protein	NA	A0A059T6G3	Listeria_phage	74.4	7.4e-27
AKG88277.1|1340062_1340446_+	preprotein translocase subunit YajC	NA	A8ATZ3	Listeria_phage	88.2	2.4e-53
AKG88278.1|1340464_1340653_+	hypothetical protein	NA	NA	NA	NA	NA
AKG88279.1|1340652_1340985_+	hypothetical protein	NA	A8ATZ5	Listeria_phage	93.1	4.5e-08
AKG88280.1|1340981_1341182_+	hypothetical protein	NA	NA	NA	NA	NA
AKG88281.1|1341174_1341429_+	DUF3850 domain-containing protein	NA	A8ATM7	Listeria_phage	82.5	5.9e-32
AKG88282.1|1341440_1342001_+	hypothetical protein	NA	A8ATM8	Listeria_phage	95.7	4.5e-101
AKG89917.1|1342081_1342504_+	hypothetical protein	NA	A8ATM9	Listeria_phage	100.0	6.3e-71
AKG88283.1|1342516_1343284_+	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	98.4	9.8e-139
AKG88284.1|1343231_1343423_+	hypothetical protein	NA	A8ATN1	Listeria_phage	94.6	2.7e-21
AKG88285.1|1343597_1344074_+	hypothetical protein	NA	A0A1P8BMT7	Lactococcus_phage	30.2	5.5e-07
AKG88286.1|1344146_1345484_+	chromosome partitioning protein ParB	NA	A8ATN5	Listeria_phage	94.8	7.2e-246
AKG88287.1|1345531_1345729_+	hypothetical protein	NA	A8ATN6	Listeria_phage	100.0	5.2e-28
AKG88288.1|1345858_1346089_+	hypothetical protein	NA	A8ATN7	Listeria_phage	98.7	3.7e-33
AKG88289.1|1346126_1346414_+	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	55.4	9.9e-20
AKG88290.1|1346455_1347340_+	hypothetical protein	NA	A8ATF9	Listeria_phage	92.9	2.2e-126
AKG88291.1|1347317_1348778_+	hypothetical protein	NA	A8ATG0	Listeria_phage	95.1	1.0e-277
AKG88292.1|1348791_1350177_+	hypothetical protein	NA	A8ATG1	Listeria_phage	98.0	9.7e-262
AKG88293.1|1350169_1351579_+|head	phage head morphogenesis protein	head	A8ATG2	Listeria_phage	98.9	5.6e-265
AKG88294.1|1351794_1352904_+	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	99.5	9.4e-175
AKG88295.1|1352903_1353353_+	hypothetical protein	NA	A8ATG5	Listeria_phage	98.0	1.0e-74
AKG88296.1|1353373_1354279_+|capsid	major capsid protein	capsid	A8ATG6	Listeria_phage	97.0	9.7e-162
AKG88297.1|1354301_1354688_+	hypothetical protein	NA	A8ATG7	Listeria_phage	98.4	2.1e-65
AKG88298.1|1354699_1355035_+	DUF4054 domain-containing protein	NA	A8ATG8	Listeria_phage	99.1	3.6e-53
AKG88299.1|1355034_1355634_+	hypothetical protein	NA	A8ATG9	Listeria_phage	98.5	3.7e-109
AKG88300.1|1355633_1356008_+	hypothetical protein	NA	A8ATH0	Listeria_phage	95.2	8.0e-62
AKG88301.1|1355997_1356480_+	hypothetical protein	NA	A8ATH1	Listeria_phage	96.9	1.1e-82
AKG88302.1|1356484_1357480_+	DUF3383 domain-containing protein	NA	A8ATH2	Listeria_phage	99.4	3.5e-181
AKG89918.2|1357496_1357895_+	hypothetical protein	NA	A8ATH3	Listeria_phage	99.2	4.0e-67
AKG89919.2|1357947_1358304_+	hypothetical protein	NA	A8ATH4	Listeria_phage	97.5	2.3e-58
AKG88303.1|1358266_1358479_+	hypothetical protein	NA	A8ATH5	Listeria_phage	91.4	1.9e-28
AKG88304.1|1358480_1363511_+|tail	phage tail tape measure protein	tail	A8ATH6	Listeria_phage	74.6	0.0e+00
AKG88305.1|1363516_1364065_+	hypothetical protein	NA	A8ATH7	Listeria_phage	84.5	7.1e-83
AKG88306.1|1364064_1364436_+	hypothetical protein	NA	A8ATH8	Listeria_phage	77.0	5.4e-50
AKG89920.1|1364441_1365248_+	hypothetical protein	NA	A8ATH9	Listeria_phage	86.9	6.1e-131
AKG88307.1|1365248_1365587_+	hypothetical protein	NA	A8ATI0	Listeria_phage	86.6	9.2e-49
AKG88308.1|1365583_1365946_+	DUF2634 domain-containing protein	NA	A8ATI1	Listeria_phage	70.0	2.0e-41
AKG88309.1|1365938_1367090_+	hypothetical protein	NA	A8ATI2	Listeria_phage	77.0	2.4e-165
AKG88310.1|1367079_1367721_+	hypothetical protein	NA	A8ATI3	Listeria_phage	99.1	4.5e-113
AKG88311.1|1367742_1368471_+	hypothetical protein	NA	A8ATI4	Listeria_phage	93.4	2.7e-130
AKG88312.1|1368476_1368818_+	hypothetical protein	NA	A8ATI5	Listeria_phage	93.5	1.5e-43
AKG88313.1|1369003_1369450_+	hypothetical protein	NA	A8ATI7	Listeria_phage	97.3	9.3e-73
AKG88314.1|1369425_1369872_+	hypothetical protein	NA	A8ATI8	Listeria_phage	95.9	1.7e-63
AKG88315.1|1369891_1370107_+	hypothetical protein	NA	A8ATI9	Listeria_phage	93.0	1.8e-26
AKG88316.1|1370117_1370372_+|holin	phage holin	holin	A8ATJ0	Listeria_phage	95.2	9.4e-38
AKG88317.1|1370374_1371208_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S7FZ94	Listeria_phage	43.8	2.5e-47
AKG88318.1|1371269_1371491_-	XRE family transcriptional regulator	NA	A8ATJ2	Listeria_phage	97.3	9.3e-34
AKG88319.1|1371518_1371722_-	hypothetical protein	NA	A8ATJ3	Listeria_phage	95.5	2.6e-30
AKG89921.1|1371735_1372101_-	hypothetical protein	NA	A8ATJ4	Listeria_phage	94.2	6.4e-56
AWG43514.1|1372410_1372644_+	hypothetical protein	NA	A8ATC5	Listeria_phage	87.0	1.1e-32
AWG43515.1|1372640_1372862_+	hypothetical protein	NA	A8ATX1	Listeria_phage	89.7	1.4e-21
>prophage 5
CP011398	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3039878	1918975	1927261	3039878		Synechococcus_phage(33.33%)	8	NA	NA
AKG88806.1|1918975_1919542_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
AKG88807.1|1919538_1920588_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
AKG88808.1|1920606_1922034_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
AKG88809.1|1922018_1924238_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.0	1.7e-159
AKG88810.1|1924230_1924914_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AKG88811.1|1924917_1925163_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AKG88812.1|1925174_1925888_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
AKG88813.1|1925968_1927261_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 6
CP011398	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3039878	2453975	2496845	3039878	tail,holin,portal,capsid,terminase,integrase,coat	Listeria_phage(95.16%)	66	2451270:2451285	2488954:2488969
2451270:2451285	attL	TGCAAAAATCACTTTC	NA	NA	NA	NA
AKG89300.1|2453975_2454173_-	hypothetical protein	NA	A8ATC6	Listeria_phage	66.1	1.7e-15
AKG89301.1|2454169_2454403_-	hypothetical protein	NA	A8ATC5	Listeria_phage	92.2	1.2e-34
AKG89302.1|2455232_2456084_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	93.3	1.4e-138
AKG89303.1|2456083_2456365_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
AKG89304.1|2456377_2456743_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
AKG89305.1|2456770_2456929_-	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
AKG89306.1|2456933_2457251_-	hypothetical protein	NA	Q9T1A2	Listeria_phage	92.4	1.3e-49
AKG89307.1|2457262_2458336_-	DUF2479 domain-containing protein	NA	Q9T1A3	Listeria_phage	95.8	9.1e-191
AKG89308.1|2458335_2459364_-	hypothetical protein	NA	Q9T1A4	Listeria_phage	98.5	3.3e-190
AKG89309.1|2459364_2460390_-	hypothetical protein	NA	Q9T1A5	Listeria_phage	88.6	1.5e-182
AKG89310.1|2460398_2461217_-|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	93.4	3.8e-149
AKG89311.1|2461218_2466582_-|tail	tail tape measure protein	tail	Q9T1A7	Listeria_phage	97.3	0.0e+00
AKG89312.1|2466592_2467192_-	hypothetical protein	NA	A0A0B5CTW0	Listeria_phage	72.0	1.9e-76
AKG89313.1|2467197_2467620_-	hypothetical protein	NA	Q9T1A9	Listeria_phage	97.9	5.9e-69
AKG89314.1|2467672_2468005_-	Ig-like virion protein	NA	Q9T1B0	Listeria_phage	70.9	1.5e-30
AKG89315.1|2467934_2468372_-|tail	phage tail protein	tail	A0A0B5CYN3	Listeria_phage	98.6	4.2e-78
AKG89316.1|2468374_2468782_-|capsid	minor capsid protein	capsid	A0A0B5CU21	Listeria_phage	98.5	1.5e-66
AKG89317.1|2468781_2469120_-|capsid	minor capsid protein	capsid	A0A059T7W4	Listeria_phage	97.3	7.0e-57
AKG89318.1|2469119_2469482_-|capsid	minor capsid protein	capsid	A0A0B5D151	Listeria_phage	91.7	1.8e-58
AKG89319.1|2469481_2469877_-	hypothetical protein	NA	A0A059T5E3	Listeria_phage	97.7	4.8e-65
AKG89320.1|2469895_2470897_-|coat	coat protein	coat	A0A059T6D4	Listeria_phage	99.4	8.2e-186
AKG89321.1|2470896_2471487_-	scaffolding protein	NA	Q9T1B8	Listeria_phage	91.5	7.7e-75
AKG89322.1|2471565_2472705_-|capsid	minor capsid protein	capsid	A0A0B5D147	Listeria_phage	96.8	4.9e-203
AKG89323.1|2472710_2474201_-|portal	portal protein	portal	Q9T1C0	Listeria_phage	99.6	3.3e-284
AKG89324.1|2474213_2475545_-|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	98.6	1.1e-259
AKG89325.1|2475513_2476056_-|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	98.9	5.4e-91
AKG89326.1|2476113_2476377_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	78.2	1.7e-34
AKG89327.1|2476403_2476703_-	hypothetical protein	NA	A0A2H4JBC0	uncultured_Caudovirales_phage	40.7	3.8e-14
AKG89328.1|2477097_2477532_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	99.3	4.3e-75
AKG89329.1|2477550_2477715_-	hypothetical protein	NA	A8ASQ0	Listeria_phage	94.4	7.4e-20
AKG89330.1|2477843_2478248_-	hypothetical protein	NA	A8AU00	Listeria_phage	98.5	2.7e-71
AKG89331.1|2478350_2478656_-	response regulator	NA	A8ATZ8	Listeria_phage	83.2	1.9e-37
AKG89332.1|2478687_2479167_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	94.4	5.4e-79
AKG89333.1|2479166_2479445_-	hypothetical protein	NA	NA	NA	NA	NA
AKG89334.1|2479441_2479843_-	hypothetical protein	NA	A0A059T6C9	Listeria_phage	76.7	1.9e-53
AKG89335.1|2479839_2480040_-	hypothetical protein	NA	NA	NA	NA	NA
AKG89336.1|2480040_2480244_-	hypothetical protein	NA	NA	NA	NA	NA
AKG89337.1|2480243_2480924_-	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	94.7	1.2e-34
AKG89339.1|2481094_2481616_-	hypothetical protein	NA	A0A059T7V5	Listeria_phage	47.8	2.4e-32
AKG89340.1|2481612_2482161_-	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	75.3	3.7e-71
AKG89341.1|2482157_2482838_-	hypothetical protein	NA	A8ATD7	Listeria_phage	97.8	3.3e-122
AKG89342.1|2482850_2483795_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.4	4.5e-178
AKG89343.1|2483805_2484519_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	7.7e-130
AKG89344.1|2484515_2485448_-	DnaD domain protein	NA	A8ATY7	Listeria_phage	89.3	2.6e-149
AKG89345.1|2485467_2486283_-	recombinase RecT	NA	Q9T172	Listeria_phage	94.8	1.7e-144
AKG89346.1|2486285_2487245_-	hypothetical protein	NA	Q9T173	Listeria_phage	83.1	8.7e-153
AKG89347.1|2487476_2487665_-	hypothetical protein	NA	A8ATY3	Listeria_phage	98.4	1.3e-28
AKG89348.1|2487772_2487988_-	hypothetical protein	NA	Q9T176	Listeria_phage	87.3	1.8e-26
AKG89349.1|2487980_2488517_-	hypothetical protein	NA	Q9T177	Listeria_phage	88.1	7.2e-80
AKG89350.1|2488638_2489418_-	phage antirepressor Ant	NA	A0A059T6E7	Listeria_phage	96.1	3.8e-138
2488954:2488969	attR	TGCAAAAATCACTTTC	NA	NA	NA	NA
AKG89351.1|2489481_2489724_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	98.8	1.5e-37
AKG89352.1|2489909_2490191_-	hypothetical protein	NA	Q9T180	Listeria_phage	96.8	1.4e-39
AKG89353.1|2490187_2490424_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
AKG89354.1|2490463_2490748_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	98.9	1.6e-46
AKG89355.1|2490759_2490954_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
AWG43527.1|2491018_2491249_+	hypothetical protein	NA	Q9T185	Listeria_phage	98.7	2.3e-35
AKG89356.1|2491177_2491444_-	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	100.0	2.5e-41
AKG89357.1|2491447_2491699_-	XRE family transcriptional regulator	NA	A8ATX6	Listeria_phage	100.0	7.6e-40
AKG89358.1|2491847_2492156_+	XRE family transcriptional regulator	NA	A8ATX5	Listeria_phage	98.0	7.8e-47
AKG89359.1|2492186_2492678_+	hypothetical protein	NA	A8ATX4	Listeria_phage	98.8	1.1e-90
AKG89360.1|2492700_2492919_+	zinc ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	97.2	1.3e-32
AKG89361.1|2492934_2493657_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	84.6	7.4e-88
AKG89362.1|2493678_2494554_+	hypothetical protein	NA	A0A0B5D0D1	Listeria_phage	94.5	2.2e-150
AKG89363.1|2494617_2495976_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	97.1	2.0e-251
AKG89364.1|2495966_2496443_+	competence protein ComK	NA	NA	NA	NA	NA
AKG89365.1|2496497_2496845_-	XRE family transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 7
CP011398	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3039878	2641167	2649009	3039878		Streptococcus_phage(50.0%)	7	NA	NA
AKG89501.1|2641167_2642139_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
AKG89502.1|2642146_2643115_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
AKG89503.1|2643116_2643992_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
AKG89504.1|2644099_2645830_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	9.5e-174
AKG89947.2|2645871_2646933_-	galactose mutarotase	NA	NA	NA	NA	NA
AKG89505.1|2646949_2647933_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
AKG89506.1|2648049_2649009_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 1
CP011399	Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence	68224	978	49051	68224	holin,protease,transposase	Listeria_phage(24.14%)	56	NA	NA
AKG89958.1|978_2070_+	carbohydrate-binding protein CenC	NA	A0A059T7R4	Listeria_phage	91.8	1.7e-189
AKG89959.1|2120_2426_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
AKG89960.1|2425_2707_+|holin	phage holin	holin	A8ATW3	Listeria_phage	100.0	3.0e-45
AKG89961.1|2706_3414_+	alkaline phosphatase	NA	A8ATW4	Listeria_phage	97.9	1.0e-129
AKG89962.1|3561_4263_+	DUF3800 domain-containing protein	NA	R4IBV1	Listeria_phage	97.8	6.4e-129
AKG89963.1|4741_4975_+	hypothetical protein	NA	A8ATX0	Listeria_phage	94.8	2.3e-35
AKG89964.1|4971_5163_+	hypothetical protein	NA	A8ATC6	Listeria_phage	98.4	1.7e-28
AKG89966.1|7253_10169_-|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.7	1.9e-174
AKG89967.1|10172_10727_-	resolvase	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
AKG89968.1|11006_11366_+	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
AKG89969.1|11365_13501_+	cadmium-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
AKG89970.1|13693_14035_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AKG89971.1|14028_14271_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AKG89972.1|14331_14583_-	hypothetical protein	NA	NA	NA	NA	NA
AKG89973.1|14713_15040_+	hypothetical protein	NA	A0A2K9V3N4	Faecalibacterium_phage	40.8	3.2e-06
AKG89974.1|15039_15702_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
AKG89975.2|15714_16098_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	53.4	2.2e-14
AKG89976.1|16256_16745_+	hypothetical protein	NA	NA	NA	NA	NA
AKG89977.1|16866_17115_+	hypothetical protein	NA	NA	NA	NA	NA
AKG89978.1|17115_17541_+	hypothetical protein	NA	NA	NA	NA	NA
AKG89979.1|17544_18267_+	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AKG89980.1|18282_18999_+	AP2 domain-containing protein	NA	O03945	Lactobacillus_phage	31.0	3.8e-20
AKG89981.1|19088_19958_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	51.1	7.1e-69
AKG89982.1|19972_20227_-	hypothetical protein	NA	Q6J1X3	Lactobacillus_phage	46.4	1.6e-13
AKG89983.1|20750_22517_+	hypothetical protein	NA	NA	NA	NA	NA
AKG89984.1|22528_23269_+	hypothetical protein	NA	NA	NA	NA	NA
AKG89985.1|23556_24165_+	resolvase	NA	A0A1W5LU24	Ralstonia_phage	42.9	1.0e-21
AKG89986.1|24154_24382_+	hypothetical protein	NA	NA	NA	NA	NA
AKG89987.1|24501_24780_-	hypothetical protein	NA	NA	NA	NA	NA
AWG43542.1|24742_24979_+	XRE family transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	53.4	6.7e-14
AKG89988.1|25406_27521_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.1	3.4e-117
AKG89989.2|27787_29137_+|transposase	transposase	transposase	A0A0C5AC89	Paenibacillus_phage	38.6	1.1e-31
AKG90040.1|29311_30046_+	ParA family protein	NA	NA	NA	NA	NA
AKG89990.1|30250_30595_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90041.2|30582_31863_+	excinuclease ABC subunit A	NA	O64031	Bacillus_phage	44.9	5.2e-92
AKG89991.1|31913_32210_-	replication and copy control-associated protein	NA	NA	NA	NA	NA
AKG89992.1|32187_33162_-	chromosome partitioning protein ParA	NA	F0PIG8	Enterococcus_phage	35.0	2.4e-33
AKG89993.1|33901_35536_+	plasmid replication protein	NA	NA	NA	NA	NA
AKG89994.1|35810_36566_+	hypothetical protein	NA	NA	NA	NA	NA
AKG89995.1|36599_37202_-	hypothetical protein	NA	U5P429	Shigella_phage	41.7	2.0e-33
AKG89996.2|37278_38076_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	63.2	3.3e-81
AKG89997.1|38044_39271_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	60.6	4.7e-135
AWG43543.1|39482_39599_+	hypothetical protein	NA	NA	NA	NA	NA
AKG89998.1|39614_39851_+	hypothetical protein	NA	NA	NA	NA	NA
AKG89999.1|39813_40203_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90000.1|40205_41123_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90001.1|41520_41760_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90002.1|41771_42212_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90003.1|42204_43545_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90004.1|43555_43927_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90005.1|43946_44711_+	Fic family protein	NA	A0A0G3Y4Q5	Ostreid_herpesvirus	29.4	2.6e-06
AKG90006.1|44824_45355_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90007.1|45391_45727_-	XRE family transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	35.0	2.8e-05
AKG90008.1|45900_46299_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90009.1|46302_47805_+	hypothetical protein	NA	H2DE57	Erwinia_phage	46.0	5.2e-11
AKG90011.1|48370_49051_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	90.7	2.6e-119
>prophage 2
CP011399	Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence	68224	56233	65698	68224	integrase	Listeria_phage(100.0%)	16	60041:60054	65555:65568
AKG90021.1|56233_57388_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	94.3	4.4e-207
AKG90022.1|57519_58092_-	hypothetical protein	NA	NA	NA	NA	NA
AKG90042.2|58143_58596_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	84.0	2.3e-71
AKG90023.1|58612_58936_-	XRE family transcriptional regulator	NA	A0A059T6G1	Listeria_phage	71.0	7.2e-35
AKG90024.1|59395_59713_-	hypothetical protein	NA	NA	NA	NA	NA
AKG90025.1|59778_59982_+	XRE family transcriptional regulator	NA	A0A059T5F8	Listeria_phage	100.0	3.1e-28
AKG90026.1|59983_60226_+	hypothetical protein	NA	A8ATD2	Listeria_phage	100.0	1.4e-43
60041:60054	attL	ACATTAGAAGAATT	NA	NA	NA	NA
AKG90027.1|60228_60414_+	hypothetical protein	NA	A0A059T7Z3	Listeria_phage	98.4	4.4e-29
AKG90028.1|60937_61651_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	98.3	5.4e-131
AKG90029.1|61661_62606_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	99.0	2.7e-178
AKG90030.1|62618_63299_+	hypothetical protein	NA	A8ATD7	Listeria_phage	96.5	1.1e-120
AKG90031.1|63295_63871_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	42.9	1.0e-31
AKG90032.1|63863_64052_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90033.1|64213_64420_+	hypothetical protein	NA	NA	NA	NA	NA
AKG90034.1|64406_64811_+	hypothetical protein	NA	R4ICD6	Listeria_phage	66.4	1.2e-42
AKG90036.1|64984_65698_+	pentapeptide repeat-containing protein	NA	A8ATE4	Listeria_phage	89.0	1.9e-35
65555:65568	attR	ACATTAGAAGAATT	NA	NA	NA	NA
