The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP011381	Moraxella bovoculi strain 58086, complete genome	2138650	1213738	1222933	2138650		Acinetobacter_phage(50.0%)	10	NA	NA
AKG17168.1|1213738_1214218_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	35.5	1.9e-15
AKG17983.2|1214662_1216183_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AKG17169.1|1216357_1216981_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	69.5	3.2e-79
AKG17170.1|1217013_1218096_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	54.1	5.2e-93
AKG17171.1|1218125_1218962_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.0	1.7e-56
AKG17172.1|1219031_1219661_-	MarC family protein	NA	NA	NA	NA	NA
AKG17173.1|1219813_1220509_+	7-cyano-7-deazaguanine synthase QueC	NA	M1PKZ7	Cellulophaga_phage	36.3	3.0e-30
AKG17174.1|1220618_1220960_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	E5E3Y9	Acinetobacter_phage	40.0	1.3e-10
AKG17175.1|1220977_1221562_+	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	53.9	7.9e-40
AKG17176.1|1221619_1222933_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	85.4	1.7e-191
>prophage 2
CP011381	Moraxella bovoculi strain 58086, complete genome	2138650	1324831	1331585	2138650		Lake_Baikal_phage(33.33%)	8	NA	NA
AKG17252.1|1324831_1326055_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	29.4	2.6e-32
AKG17253.1|1326162_1326546_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.8	3.8e-51
AKG17254.1|1326571_1326892_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.9	7.4e-24
AKG17255.1|1326901_1327423_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AKG17256.1|1327536_1329405_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	38.6	1.4e-98
AKG17257.1|1329442_1329781_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AKG17258.2|1329824_1330472_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.7e-25
AKG17999.1|1330541_1331585_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.8	7.7e-78
>prophage 3
CP011381	Moraxella bovoculi strain 58086, complete genome	2138650	1833186	1899486	2138650	transposase,tRNA,integrase	Moraxella_phage(21.43%)	56	1844420:1844464	1882360:1882404
AKG17652.1|1833186_1833624_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AKG17653.1|1833998_1836953_+	peptidase M16	NA	NA	NA	NA	NA
AKG17654.1|1837021_1839109_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AKG17655.1|1839186_1839519_-	hypothetical protein	NA	NA	NA	NA	NA
AKG17656.1|1839557_1840499_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AKG17657.1|1840605_1840848_-	PspC domain-containing protein	NA	NA	NA	NA	NA
AKG17658.1|1841098_1842109_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	K4F711	Cronobacter_phage	28.2	2.3e-26
AKG17659.1|1842120_1842864_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
AKG17660.1|1842898_1843327_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
AKG17661.1|1843365_1844013_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
1844420:1844464	attL	TTGCCAAGGTTGGGGTCGCGAGTTCGAATCTCGTTTCCCGCTCCA	NA	NA	NA	NA
AKG17662.1|1844789_1845020_-	XRE family transcriptional regulator	NA	A0A1P8BMN9	Lactococcus_phage	40.6	1.3e-09
AKG17663.1|1845191_1845407_+	hypothetical protein	NA	NA	NA	NA	NA
AXR99013.1|1845419_1846679_+|integrase	site-specific integrase	integrase	Q76UT6	Pseudomonas_virus	28.9	3.8e-15
AKG17664.1|1846675_1846987_+	hypothetical protein	NA	NA	NA	NA	NA
AKG17665.1|1847059_1847371_+	hypothetical protein	NA	NA	NA	NA	NA
AKG18042.2|1847612_1848668_-	hypothetical protein	NA	NA	NA	NA	NA
AKG17666.1|1848657_1849896_-	DNA (cytosine-5-)-methyltransferase	NA	E5EQN8	Micromonas_sp._RCC1109_virus	38.3	1.4e-49
AKG17667.1|1849992_1851264_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.3	2.1e-85
AKG17668.1|1851265_1851916_-	DNA polymerase V	NA	A0A2H4J538	uncultured_Caudovirales_phage	46.4	2.0e-36
AKG17669.1|1852564_1852930_+	hypothetical protein	NA	NA	NA	NA	NA
AXR99014.1|1852899_1854879_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AKG17670.1|1855247_1855451_+	hypothetical protein	NA	NA	NA	NA	NA
AXR99015.1|1855860_1856073_-	hypothetical protein	NA	NA	NA	NA	NA
AXR99016.1|1856077_1856257_-	hypothetical protein	NA	NA	NA	NA	NA
AXR99017.1|1856634_1857567_+	hypothetical protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	34.9	3.2e-19
AKG17671.1|1857569_1858358_+	hypothetical protein	NA	NA	NA	NA	NA
AKG17672.1|1858312_1859179_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	35.4	4.4e-18
AKG17673.1|1859310_1859997_-	hypothetical protein	NA	NA	NA	NA	NA
AXR99018.1|1859993_1860950_-	hypothetical protein	NA	NA	NA	NA	NA
AXR99019.1|1861160_1861781_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXR99020.1|1861925_1862873_-	hypothetical protein	NA	NA	NA	NA	NA
AXR99021.1|1863092_1863245_+|transposase	transposase	transposase	NA	NA	NA	NA
AKG17674.2|1863361_1864267_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.7	5.5e-64
AKG17675.1|1864252_1864432_-	hypothetical protein	NA	NA	NA	NA	NA
AKG17676.1|1864479_1864854_-	hypothetical protein	NA	NA	NA	NA	NA
AKG17677.1|1864840_1865674_-	hypothetical protein	NA	NA	NA	NA	NA
AKG17678.1|1865711_1866077_-	hypothetical protein	NA	NA	NA	NA	NA
AKG17679.1|1866081_1876020_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.8	3.6e-47
AKG17680.1|1876248_1879386_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AKG17681.1|1879375_1881628_-	hypothetical protein	NA	NA	NA	NA	NA
AKG17682.1|1881614_1882118_-	hypothetical protein	NA	NA	NA	NA	NA
AKG18043.1|1882630_1882846_-	XRE family transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	36.8	3.2e-07
1882360:1882404	attR	TTGCCAAGGTTGGGGTCGCGAGTTCGAATCTCGTTTCCCGCTCCA	NA	NA	NA	NA
AXR99022.1|1883274_1885107_+	hypothetical protein	NA	A0A0R6PJK4	Moraxella_phage	70.6	2.7e-70
AKG17683.1|1885699_1886377_+	hypothetical protein	NA	NA	NA	NA	NA
AKG17684.1|1886407_1887292_+	hypothetical protein	NA	NA	NA	NA	NA
AXR99023.1|1887372_1888812_+	hypothetical protein	NA	A0A0R6PJK4	Moraxella_phage	32.7	4.7e-17
AKG17685.1|1888814_1889219_+	hypothetical protein	NA	NA	NA	NA	NA
AKG17687.1|1889923_1890481_+	hypothetical protein	NA	NA	NA	NA	NA
AKG17688.1|1891660_1892149_+	hypothetical protein	NA	NA	NA	NA	NA
AXR99024.1|1892197_1892389_+	hypothetical protein	NA	NA	NA	NA	NA
AKG18046.1|1892388_1892928_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AXR99025.1|1894284_1894611_+	hypothetical protein	NA	NA	NA	NA	NA
AKG17690.1|1894853_1895213_+	hypothetical protein	NA	NA	NA	NA	NA
AKG17691.1|1895435_1896206_+	hypothetical protein	NA	NA	NA	NA	NA
AXR99026.1|1896192_1896378_+	hypothetical protein	NA	NA	NA	NA	NA
AXR99027.1|1899120_1899486_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	44.3	2.6e-17
