The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	0	40761	4876999	head,terminase,holin,transposase,tail	Enterobacteria_phage(30.61%)	58	NA	NA
AVG33286.1|394_679_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVG33287.1|730_916_-	hypothetical protein	NA	M9NZE1	Enterobacteria_phage	79.5	3.1e-14
AVG33288.1|908_1295_-	helix-turn-helix domain-containing protein	NA	A0A221SAP1	Ralstonia_phage	52.8	4.0e-16
AVG33289.1|1525_2371_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	4.8e-70
AVG33290.1|2389_2674_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	96.8	1.3e-48
AVG33291.1|2744_2954_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	4.4e-33
AVG33292.1|3105_3327_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	45.3	1.7e-06
AVG33293.1|4349_4547_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	79.7	8.9e-20
AVG33294.1|4921_5269_-	hypothetical protein	NA	NA	NA	NA	NA
AVG37687.1|5504_6224_-	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	92.5	4.7e-127
AVG33295.1|6341_6563_+	transcriptional regulator	NA	K7P6H5	Enterobacteria_phage	89.0	1.2e-28
AVG33296.1|6600_6822_+	transcriptional regulator	NA	NA	NA	NA	NA
AVG33297.1|6904_7759_+	replication protein	NA	K7PGT1	Enterobacteria_phage	52.2	3.8e-59
AVG33298.1|7743_8616_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	68.3	1.3e-94
AVG33299.1|8787_9132_+	Ren protein	NA	K7PHG5	Enterobacteria_phage	94.7	8.8e-55
AVG33300.1|9562_9958_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33301.1|9959_10196_+	hypothetical protein	NA	A0A2H4PHJ9	Dickeya_phage	52.6	1.5e-10
AVG33302.1|10192_10813_+	hypothetical protein	NA	G8C7V0	Escherichia_phage	40.1	8.8e-13
AVG33303.1|10809_11118_+	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	89.2	1.8e-51
AVG33304.1|11236_11413_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33305.1|11604_12054_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	52.7	1.3e-37
AVG33306.1|12046_12217_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	98.1	4.8e-22
AVG33307.1|12209_12821_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	73.4	1.5e-60
AVG33308.1|12817_13015_+	hypothetical protein	NA	M9NZE6	Enterobacteria_phage	89.2	3.3e-30
AVG33309.1|13011_13128_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33310.1|13124_13814_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	2.5e-56
AVG33311.1|14327_14669_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	54.2	8.2e-29
AVG37688.1|14652_15096_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	70.5	1.3e-50
AVG33312.1|15092_15479_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	37.8	5.5e-13
AVG33313.1|15459_15648_+	rz1 lytic protein	NA	U5P461	Shigella_phage	56.1	7.2e-11
AVG33314.1|15742_15955_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33315.1|15944_16208_-	hypothetical protein	NA	NA	NA	NA	NA
AVG33316.1|16313_16916_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	85.4	3.6e-80
AVG33317.1|16915_18388_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.7	2.4e-250
AVG33318.1|18400_19870_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.8	5.3e-149
AVG33319.1|19796_20804_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.8	3.8e-114
AVG33320.1|20925_22320_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	51.9	3.1e-122
AVG33321.1|22319_22754_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	47.8	1.8e-25
AVG33322.1|22765_23797_+	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	54.1	3.0e-98
AVG33323.1|23836_24124_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	75.6	1.4e-13
AVG33324.1|24126_24510_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	74.0	1.3e-46
AVG33325.1|24509_24683_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	50.9	4.1e-13
AVG33326.1|24682_25039_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	53.0	1.2e-25
AVG33327.1|25041_25410_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	66.4	3.2e-39
AVG33328.1|25406_25790_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	57.5	4.9e-38
AVG33329.1|25847_26591_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	91.1	4.4e-120
AVG33330.1|26650_27331_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	67.7	2.9e-86
AVG33331.1|27438_28035_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33332.1|31523_31874_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	83.6	1.6e-51
AVG33333.1|31910_32615_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	96.6	1.5e-133
AVG33334.1|32614_33334_+|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	79.0	3.1e-118
AVG37689.1|33276_33804_+|tail	phage tail protein	tail	H6WRW3	Salmonella_phage	87.9	2.4e-67
AVG33335.1|33813_37347_+	DUF1983 domain-containing protein	NA	A0A1V0E5M1	Salmonella_phage	66.0	0.0e+00
AVG33336.1|37346_38294_+	hypothetical protein	NA	G5DMH8	Enterobacter_virus	48.1	3.5e-77
AVG33337.1|38350_39661_+	hypothetical protein	NA	K7PGY2	Enterobacteria_phage	56.2	1.3e-103
AVG33338.1|39779_40046_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	95.5	2.8e-40
AVG33339.1|40132_40372_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	84.8	3.1e-35
AVG33340.1|40371_40761_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	96.9	3.9e-67
>prophage 2
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	52433	53732	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG33350.1|52433_53732_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	6.1e-16
>prophage 3
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	63409	65189	4876999		Enterobacteria_phage(50.0%)	3	NA	NA
AVG33359.1|63409_63604_-	hypothetical protein	NA	K7PGY7	Enterobacteria_phage	58.1	5.1e-12
AVG33360.1|63737_64490_-	transcriptional regulator FNR	NA	NA	NA	NA	NA
AVG33361.1|64673_65189_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.2	4.9e-25
>prophage 4
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	71555	76486	4876999		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
AVG33367.1|71555_73217_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	2.0e-11
AVG33368.1|73361_74228_+	oxidoreductase	NA	NA	NA	NA	NA
AVG33369.1|74273_74474_-	hypothetical protein	NA	NA	NA	NA	NA
AVG33370.1|74805_75240_+	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	55.3	2.3e-36
AVG33371.1|75223_76486_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	69.4	3.0e-169
>prophage 5
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	81710	82406	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG33376.1|81710_82406_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.2	1.1e-27
>prophage 6
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	97840	98989	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG33393.1|97840_98989_-	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.0	4.9e-25
>prophage 7
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	109429	110550	4876999	transposase	Leptospira_phage(100.0%)	1	NA	NA
AVG33407.1|109429_110550_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 8
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	122874	138813	4876999		Escherichia_phage(22.22%)	16	NA	NA
AVG33417.1|122874_123489_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.4	7.3e-28
AVG33418.1|123582_126021_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	6.6e-213
AVG33419.1|126152_126419_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVG33420.1|126523_127234_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVG33421.1|127251_127812_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVG33422.1|127811_128150_-	hypothetical protein	NA	NA	NA	NA	NA
AVG33423.1|128302_128629_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	1.4e-22
AVG33424.1|128739_129954_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.4	1.4e-46
AVG33425.1|129968_130988_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.7	1.3e-18
AVG33426.1|131061_132429_+	MFS transporter	NA	NA	NA	NA	NA
AVG33427.1|132649_134113_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.8	8.6e-43
AVG33428.1|134156_134360_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
AVG33429.1|134647_135079_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	35.9	8.2e-18
AVG33430.1|135112_135799_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVG33431.1|135890_136637_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AVG33432.1|136779_138813_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	23.1	8.7e-17
>prophage 9
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	141818	145845	4876999		Morganella_phage(33.33%)	4	NA	NA
AVG33434.1|141818_142253_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	49.7	2.6e-27
AVG33435.1|142497_143169_-	magnesium transport protein MgtC	NA	G3MA03	Bacillus_virus	40.8	1.7e-14
AVG33436.1|143627_144836_+	MFS transporter	NA	NA	NA	NA	NA
AVG33437.1|144855_145845_-	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	44.7	1.2e-69
>prophage 10
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	156414	157338	4876999	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVG37692.1|156414_157338_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
>prophage 11
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	174594	175077	4876999		Canarypox_virus(100.0%)	1	NA	NA
AVG33464.1|174594_175077_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	39.5	8.6e-24
>prophage 12
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	189364	190159	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG33479.1|189364_190159_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	31.9	3.7e-08
>prophage 13
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	211310	217530	4876999		Bodo_saltans_virus(33.33%)	4	NA	NA
AVG33510.1|211310_211997_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.4	4.5e-10
AVG33511.1|212086_212692_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AVG33512.1|212897_216800_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	1.7e-53
AVG33513.1|216870_217530_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	50.4	8.4e-30
>prophage 14
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	226007	228407	4876999		Escherichia_phage(100.0%)	3	NA	NA
AVG33520.1|226007_226538_+	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.7e-20
AVG33521.1|226582_227650_-	oxidoreductase	NA	NA	NA	NA	NA
AVG33522.1|227663_228407_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.4	6.0e-16
>prophage 15
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	248787	250968	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG33525.1|248787_250968_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.4	1.9e-30
>prophage 16
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	265877	268848	4876999		Synechococcus_phage(50.0%)	2	NA	NA
AVG37697.1|265877_266996_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	2.1e-33
AVG33539.1|267156_268848_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.4	1.3e-05
>prophage 17
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	272680	273565	4876999		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVG33542.1|272680_273565_-	KR domain-containing protein	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.0	1.4e-80
>prophage 18
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	280780	285202	4876999		Mycobacterium_phage(50.0%)	5	NA	NA
AVG33548.1|280780_280984_-	hypothetical protein	NA	W8ED25	Mycobacterium_phage	44.4	7.5e-06
AVG33549.1|281007_281502_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AVG33550.1|281596_281782_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AVG33551.1|282309_283653_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AVG33552.1|283696_285202_+	carboxylesterase/lipase family protein	NA	S4VZJ7	Pandoravirus	30.9	5.4e-32
>prophage 19
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	297268	301952	4876999		Bordetella_phage(50.0%)	4	NA	NA
AVG33564.1|297268_298141_+	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	47.2	3.5e-15
AVG33565.1|298120_299287_-	benzoate transporter	NA	NA	NA	NA	NA
AVG33566.1|299379_299907_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVG33567.1|299987_301952_+	U32 family peptidase	NA	Q6DW11	Phage_TP	27.6	7.8e-23
>prophage 20
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	305181	306285	4876999		uncultured_virus(100.0%)	1	NA	NA
AVG33572.1|305181_306285_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.6	8.9e-101
>prophage 21
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	310428	311934	4876999		Brazilian_cedratvirus(50.0%)	2	NA	NA
AVG33576.1|310428_311226_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	25.9	4.7e-11
AVG33577.1|311235_311934_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.8e-14
>prophage 22
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	315247	315634	4876999		Streptococcus_phage(100.0%)	1	NA	NA
AVG33581.1|315247_315634_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	33.3	2.1e-09
>prophage 23
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	323037	327525	4876999		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AVG33590.1|323037_324627_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.4	2.4e-14
AVG33591.1|324689_325616_+	glutaminase	NA	NA	NA	NA	NA
AVG33592.1|325615_325972_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
AVG33593.1|326085_327525_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.1	9.1e-21
>prophage 24
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	335281	337317	4876999		Bacillus_phage(100.0%)	2	NA	NA
AVG33603.1|335281_336022_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.8	7.7e-32
AVG33604.1|336018_337317_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.6	4.8e-13
>prophage 25
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	355083	355767	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG33619.1|355083_355767_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	9.3e-32
>prophage 26
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	360218	362894	4876999	transposase	Escherichia_phage(50.0%)	3	NA	NA
AVG33624.1|360218_361199_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AVG33625.1|361386_361632_-	hypothetical protein	NA	NA	NA	NA	NA
AVG33626.1|361774_362894_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 27
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	392852	396944	4876999		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AVG33650.1|392852_394403_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.6	8.6e-09
AVG33651.1|394492_395509_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVG33652.1|395537_396944_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	24.5	1.1e-15
>prophage 28
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	409030	411685	4876999		Planktothrix_phage(66.67%)	3	NA	NA
AVG33663.1|409030_410017_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	1.6e-16
AVG33664.1|410009_410939_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	1.7e-12
AVG33665.1|410935_411685_-	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	1.1e-17
>prophage 29
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	418991	421911	4876999		Tupanvirus(100.0%)	2	NA	NA
AVG33674.1|418991_420704_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	26.5	4.7e-40
AVG33675.1|420900_421911_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.6e-27
>prophage 30
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	425479	427087	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG33679.1|425479_427087_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	7.8e-21
>prophage 31
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	439122	456178	4876999		Enterobacteria_phage(14.29%)	16	NA	NA
AVG33689.1|439122_440205_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	69.8	2.4e-146
AVG33690.1|440282_440723_+	GFA family protein	NA	NA	NA	NA	NA
AVG33691.1|440712_441657_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.8	5.4e-14
AVG33692.1|441827_442778_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVG33693.1|442786_443893_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AVG33694.1|443889_444657_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.2e-14
AVG33695.1|444649_445369_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.7	1.6e-10
AVG33696.1|445397_446555_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG33697.1|446573_447056_+	2-amino-thiazoline-4-carboxylic acid hydrolase	NA	NA	NA	NA	NA
AVG33698.1|447052_448279_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AVG37709.1|448318_450202_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.6	2.8e-78
AVG33699.1|450279_451767_-	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	35.0	1.5e-34
AVG33700.1|451883_452477_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVG33701.1|452516_453362_-	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
AVG33702.1|453470_454043_+	flavin reductase family protein	NA	NA	NA	NA	NA
AVG33703.1|454078_456178_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	2.8e-63
>prophage 32
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	459593	460925	4876999		Dickeya_phage(100.0%)	1	NA	NA
AVG33708.1|459593_460925_-	malate permease	NA	A0A140XAH4	Dickeya_phage	57.4	3.3e-25
>prophage 33
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	464039	468028	4876999		Morganella_phage(50.0%)	5	NA	NA
AVG33711.1|464039_465041_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.3	4.4e-54
AVG33712.1|465238_465469_-	Tautomerase PptA	NA	NA	NA	NA	NA
AVG33713.1|465506_466124_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AVG33714.1|466357_467245_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG33715.1|467254_468028_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.4e-20
>prophage 34
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	474861	476397	4876999		Salmonella_phage(100.0%)	1	NA	NA
AVG33722.1|474861_476397_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	54.0	7.4e-37
>prophage 35
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	480975	483090	4876999		Salmonella_phage(100.0%)	1	NA	NA
AVG33727.1|480975_483090_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	69.1	4.5e-141
>prophage 36
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	500078	501092	4876999		Mycoplasma_phage(100.0%)	1	NA	NA
AVG33743.1|500078_501092_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.9	1.5e-25
>prophage 37
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	512155	513265	4876999		Enterobacteria_phage(100.0%)	1	NA	NA
AVG33752.1|512155_513265_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	61.0	2.3e-120
>prophage 38
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	519500	530416	4876999	tRNA	Bacillus_phage(33.33%)	10	NA	NA
AVG33759.1|519500_519719_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	64.7	2.2e-19
AVG33760.1|520168_520396_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33761.1|520822_521143_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVG33762.1|521388_522324_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.9	2.2e-140
AVG33763.1|522366_523740_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.5	6.2e-51
AVG33764.1|523767_523950_-	hypothetical protein	NA	NA	NA	NA	NA
AVG33765.1|524223_525207_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVG33766.1|525362_526505_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	6.8e-11
AVG33767.1|526961_529091_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	28.7	1.8e-09
AVG33768.1|529183_530416_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	1.2e-16
>prophage 39
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	543391	545153	4876999		Planktothrix_phage(50.0%)	2	NA	NA
AVG33781.1|543391_544474_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-20
AVG33782.1|544484_545153_-	beta-phosphoglucomutase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	28.3	2.8e-09
>prophage 40
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	561557	570999	4876999		Planktothrix_phage(25.0%)	8	NA	NA
AVG33798.1|561557_562550_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.5	9.4e-09
AVG33799.1|562551_563358_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	29.1	1.6e-14
AVG33800.1|563518_564460_+	glycosyl transferase	NA	NA	NA	NA	NA
AVG33801.1|564440_565505_-	sensor histidine kinase	NA	NA	NA	NA	NA
AVG33802.1|565501_566206_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.4	6.4e-28
AVG37713.1|566453_566864_+	transporter	NA	NA	NA	NA	NA
AVG37714.1|567035_567899_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33803.1|567903_570999_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.4	2.2e-51
>prophage 41
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	575542	577534	4876999		Bacillus_virus(100.0%)	1	NA	NA
AVG33807.1|575542_577534_+	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	32.6	1.5e-18
>prophage 42
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	584008	584599	4876999		Staphylococcus_phage(100.0%)	1	NA	NA
AVG33816.1|584008_584599_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.0e-42
>prophage 43
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	589524	597768	4876999	protease,transposase	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
AVG33820.1|589524_592122_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	35.5	5.6e-85
AVG33821.1|592521_592773_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33822.1|592807_593854_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	1.4e-18
AVG33823.1|594105_594867_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.7	7.5e-06
AVG33824.1|594863_595454_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AVG33825.1|595489_596365_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
AVG33826.1|596647_597768_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 44
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	615034	616309	4876999	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVG33843.1|615034_616309_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.3	2.5e-86
>prophage 45
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	624748	625267	4876999		Salmonella_phage(100.0%)	1	NA	NA
AVG33852.1|624748_625267_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	57.2	2.2e-49
>prophage 46
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	632084	640701	4876999		Bacillus_phage(25.0%)	9	NA	NA
AVG33861.1|632084_632858_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	39.5	3.3e-17
AVG33862.1|632980_633562_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
AVG33863.1|633600_634767_-	MFS transporter	NA	NA	NA	NA	NA
AVG33864.1|634930_635020_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AVG33865.1|635317_636343_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.9	9.7e-33
AVG33866.1|636361_637273_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG33867.1|637387_638578_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AVG33868.1|638876_640025_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.2	1.6e-81
AVG33869.1|640056_640701_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	2.0e-23
>prophage 47
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	647449	648265	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG33875.1|647449_648265_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	1.5e-36
>prophage 48
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	651512	654306	4876999		Planktothrix_phage(50.0%)	2	NA	NA
AVG33881.1|651512_652535_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	5.3e-31
AVG33882.1|652935_654306_+	CBS domain-containing protein	NA	A0A1W6JHY1	Lactococcus_phage	37.1	3.2e-47
>prophage 49
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	659410	665539	4876999		environmental_halophage(25.0%)	7	NA	NA
AVG33889.1|659410_660631_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	2.6e-93
AVG33890.1|660627_661899_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AVG33891.1|661873_662620_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	30.8	1.4e-09
AVG33892.1|662629_664120_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVG33893.1|664128_664497_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	42.2	2.3e-16
AVG33894.1|664485_664752_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33895.1|664810_665539_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.3	7.3e-51
>prophage 50
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	679982	684729	4876999		Hokovirus(50.0%)	3	NA	NA
AVG33907.1|679982_682361_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	1.4e-172
AVG33908.1|682696_683530_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AVG33909.1|683682_684729_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	46.0	4.8e-80
>prophage 51
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	690047	690827	4876999		Pithovirus(100.0%)	1	NA	NA
AVG33915.1|690047_690827_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.7	1.5e-14
>prophage 52
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	696672	709324	4876999	tRNA	Microcystis_phage(14.29%)	13	NA	NA
AVG33922.1|696672_698115_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.6	8.2e-54
AVG33923.1|698176_698893_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AVG33924.1|699187_699652_-	endopeptidase	NA	S5MM68	Bacillus_phage	33.8	1.6e-11
AVG33925.1|699726_700482_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.9	5.5e-09
AVG33926.1|700481_701033_-	glutathione peroxidase	NA	NA	NA	NA	NA
AVG33927.1|701067_702048_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AVG33928.1|702151_702451_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVG33929.1|702455_704843_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVG33930.1|704858_705842_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	3.8e-34
AVG33931.1|706146_706503_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVG33932.1|706554_706752_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVG33933.1|706849_707392_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.5	1.7e-15
AVG33934.1|707395_709324_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	5.7e-127
>prophage 53
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	717470	719699	4876999		Tupanvirus(100.0%)	1	NA	NA
AVG33944.1|717470_719699_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	47.8	1.8e-137
>prophage 54
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	725905	726733	4876999		Bacillus_virus(100.0%)	1	NA	NA
AVG33952.1|725905_726733_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	8.5e-72
>prophage 55
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	734257	735478	4876999		Klosneuvirus(100.0%)	1	NA	NA
AVG33959.1|734257_735478_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.8	2.8e-23
>prophage 56
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	740085	740706	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG33964.1|740085_740706_+	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.3e-13
>prophage 57
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	745635	747543	4876999		Streptococcus_phage(100.0%)	1	NA	NA
AVG33971.1|745635_747543_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.8	6.8e-40
>prophage 58
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	752371	753013	4876999		Tupanvirus(100.0%)	1	NA	NA
AVG33976.1|752371_753013_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	35.8	4.2e-18
>prophage 59
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	759352	760636	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG33983.1|759352_760636_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
>prophage 60
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	766019	777259	4876999	transposase	Escherichia_phage(40.0%)	10	NA	NA
AVG33992.1|766019_766943_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AVG37723.1|767217_768246_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.2	3.7e-16
AVG33993.1|768291_768390_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33994.1|768520_768769_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AVG37724.1|769053_770526_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.8	2.9e-14
AVG37725.1|770651_772172_-	hypothetical protein	NA	NA	NA	NA	NA
AVG37726.1|772869_773793_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AVG33995.1|775263_775509_-	DUF2543 domain-containing protein	NA	NA	NA	NA	NA
AVG33996.1|775583_775931_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AVG33997.1|776008_777259_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
>prophage 61
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	780341	781712	4876999		Bodo_saltans_virus(100.0%)	1	NA	NA
AVG34002.1|780341_781712_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.0	3.8e-109
>prophage 62
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	786765	788725	4876999		Mycoplasma_phage(100.0%)	2	NA	NA
AVG34006.1|786765_787884_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	37.3	6.4e-30
AVG34007.1|787867_788725_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.5	1.2e-12
>prophage 63
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	792055	800301	4876999		uncultured_Caudovirales_phage(25.0%)	7	NA	NA
AVG34011.1|792055_793987_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.0	3.1e-08
AVG34012.1|794032_794854_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	1.6e-22
AVG34013.1|794868_795780_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVG34014.1|795833_797078_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AVG34015.1|797077_797779_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.9	2.6e-37
AVG34016.1|797771_799019_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
AVG34017.1|799227_800301_+	hypothetical protein	NA	A0A142KBN9	Gordonia_phage	24.7	1.4e-05
>prophage 64
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	815589	817232	4876999		Erwinia_phage(50.0%)	2	NA	NA
AVG34030.1|815589_816594_-	DNA polymerase III subunit delta'	NA	A0A2H4IBD4	Erwinia_phage	28.4	1.5e-06
AVG34031.1|816590_817232_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	40.1	8.2e-30
>prophage 65
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	820511	821637	4876999		Ralstonia_phage(50.0%)	2	NA	NA
AVG34035.1|820511_820748_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	3.4e-10
AVG34036.1|820902_821637_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	1.3e-15
>prophage 66
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	835889	836843	4876999		Synechococcus_phage(100.0%)	1	NA	NA
AVG34049.1|835889_836843_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A1D7R817	Synechococcus_phage	37.5	3.7e-10
>prophage 67
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	852527	852773	4876999		Salmonella_phage(100.0%)	1	NA	NA
AVG34069.1|852527_852773_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	52.6	1.0e-12
>prophage 68
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	857378	858305	4876999		Morganella_phage(100.0%)	1	NA	NA
AVG34074.1|857378_858305_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.8	1.1e-54
>prophage 69
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	865956	866499	4876999		Scale_drop_disease_virus(100.0%)	1	NA	NA
AVG34081.1|865956_866499_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	47.6	1.0e-25
>prophage 70
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	870706	874500	4876999		Pelagibacter_phage(50.0%)	5	NA	NA
AVG34089.1|870706_871540_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	38.8	7.8e-41
AVG34090.1|871584_872076_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
AVG34091.1|872163_872718_-	molecular chaperone	NA	NA	NA	NA	NA
AVG34092.1|872739_873477_-	phosphatase	NA	NA	NA	NA	NA
AVG34093.1|873561_874500_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	26.7	2.7e-05
>prophage 71
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	879976	881044	4876999		Cronobacter_phage(100.0%)	1	NA	NA
AVG34098.1|879976_881044_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.4	5.6e-92
>prophage 72
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	897421	900459	4876999		Enterobacteria_phage(100.0%)	4	NA	NA
AVG34113.1|897421_897916_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	83.3	7.2e-42
AVG34114.1|897937_899260_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	89.3	4.4e-211
AVG34115.1|899247_900171_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVG34116.1|900288_900459_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 73
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	904947	905697	4876999		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVG34123.1|904947_905697_+	short-chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.4	1.4e-20
>prophage 74
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	910072	910810	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG34128.1|910072_910810_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.9	1.5e-35
>prophage 75
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	929081	931630	4876999		Pseudomonas_phage(50.0%)	2	NA	NA
AVG34148.1|929081_930200_+	membrane-bound O-acyltransferase	NA	A0A125RNP0	Pseudomonas_phage	32.2	1.1e-21
AVG34149.1|930196_931630_+	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	23.8	2.5e-26
>prophage 76
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	936380	937040	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG34156.1|936380_937040_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	1.7e-46
>prophage 77
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	942726	944781	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG34167.1|942726_944781_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	5.1e-17
>prophage 78
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	950955	1027589	4876999	capsid,portal,head,terminase,holin,protease,tRNA,tail	Enterobacterial_phage(21.43%)	84	NA	NA
AVG34173.1|950955_952716_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AVG34174.1|952784_953303_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AVG34175.1|953374_953542_-	ribosome modulation factor	NA	NA	NA	NA	NA
AVG34176.1|953797_954364_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34177.1|954360_956001_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AVG34178.1|956005_957259_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVG34179.1|957272_959180_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	9.5e-50
AVG34180.1|959192_961301_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AVG34181.1|961399_962509_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVG34182.1|962505_963048_-	cell division protein ZapC	NA	NA	NA	NA	NA
AVG34183.1|963213_964224_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AVG34184.1|964472_965048_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AVG34185.1|965040_966003_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG34186.1|965999_967145_+	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AVG34187.1|967154_967946_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AVG34188.1|967942_968713_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.2e-29
AVG34189.1|968809_971422_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.0	9.1e-19
AVG34190.1|971846_972113_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	2.3e-39
AVG34191.1|972231_973542_-	hypothetical protein	NA	K7PGY2	Enterobacteria_phage	56.2	1.3e-103
AVG34192.1|973600_973834_-	cor protein	NA	E4WL42	Enterobacteria_phage	88.3	3.7e-33
AVG34193.1|973945_974620_-	hypothetical protein	NA	K7PKY0	Enterobacterial_phage	91.3	1.9e-109
AVG34194.1|974619_974922_-	hypothetical protein	NA	K7PHM8	Enterobacterial_phage	96.0	1.1e-48
AVG34195.1|974921_978380_-	host specificity protein J	NA	K7PHL5	Enterobacterial_phage	68.9	0.0e+00
AVG34196.1|978433_979021_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.9	8.0e-48
AVG34197.1|979020_979731_-	peptidase P60	NA	F1C573	Cronobacter_phage	71.1	9.2e-99
AVG34198.1|979733_980492_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.0e-95
AVG34199.1|980488_980827_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
AVG34200.1|980829_984321_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	87.4	0.0e+00
AVG34201.1|984367_984703_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	94.6	3.6e-53
AVG34202.1|984757_985036_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	8.1e-43
AVG34203.1|985044_985428_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
AVG34204.1|985436_985880_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	2.7e-72
AVG34205.1|985939_986287_-	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	95.7	7.2e-57
AVG34206.1|986283_986733_-	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	99.3	4.5e-75
AVG34207.1|986729_987068_-|head,tail	head-tail adaptor protein	head,tail	K7P7L2	Enterobacteria_phage	100.0	2.9e-58
AVG34208.1|987067_987394_-	hypothetical protein	NA	K7PGU9	Enterobacterial_phage	100.0	2.6e-56
AVG34209.1|987427_988585_-|capsid	phage major capsid protein	capsid	Q77WA0	Escherichia_phage	97.4	8.0e-209
AVG34210.1|988587_989265_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	100.0	2.4e-125
AVG34211.1|989282_990557_-|portal	phage portal protein	portal	Q9MCV6	Escherichia_phage	97.6	4.4e-245
AVG34212.1|990556_992071_-|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	95.0	2.4e-282
AVG34213.1|992077_992563_-|terminase	terminase	terminase	K7PGU7	Enterobacterial_phage	94.4	3.9e-77
AVG34214.1|992746_992950_-	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	82.1	1.4e-23
AVG34215.1|992949_993291_-	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	100.0	2.7e-64
AVG34216.1|993287_993866_-	hypothetical protein	NA	K7P7D2	Enterobacteria_phage	81.4	1.6e-88
AVG34217.1|993859_994447_-	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.8	1.2e-14
AVG34218.1|994500_995958_-	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	93.0	4.7e-275
AVG34219.1|995969_996794_-	hypothetical protein	NA	K7PH02	Enterobacteria_phage	75.0	9.2e-18
AVG34220.1|996919_997114_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	87.8	3.7e-18
AVG34221.1|997070_997340_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	77.5	1.2e-27
AVG34222.1|997336_997879_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	74.3	6.2e-79
AVG34223.1|997878_998157_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	97.8	4.7e-43
AVG34224.1|998146_998536_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	99.2	8.9e-64
AVG34225.1|999041_999269_+	hypothetical protein	NA	NA	NA	NA	NA
AVG34226.1|999315_999801_-	HNH endonuclease	NA	A0A2I7RSG2	Vibrio_phage	43.2	3.5e-25
AVG34227.1|1000095_1000911_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	75.3	2.5e-116
AVG34228.1|1000914_1002786_-	bifunctional DNA primase/helicase	NA	Q5G8S8	Enterobacteria_phage	59.7	3.7e-224
AVG34229.1|1002889_1003912_-	hypothetical protein	NA	V5URT9	Shigella_phage	56.3	2.4e-47
AVG34230.1|1003904_1004114_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVG34231.1|1004115_1004346_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG34232.1|1004308_1005181_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	36.1	2.6e-34
AVG34233.1|1005356_1005788_+	transcriptional regulator	NA	NA	NA	NA	NA
AVG34234.1|1005854_1006241_+	helix-turn-helix transcriptional regulator	NA	F1C5A0	Cronobacter_phage	61.1	5.8e-39
AVG34235.1|1006347_1006569_+	hypothetical protein	NA	NA	NA	NA	NA
AVG34236.1|1006561_1006969_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	85.7	1.8e-46
AVG34237.1|1006940_1007162_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.9e-18
AVG34238.1|1007158_1007566_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	47.4	2.8e-23
AVG34239.1|1007565_1008144_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	75.0	6.1e-85
AVG34240.1|1008155_1008899_+	hypothetical protein	NA	A0A1B5FPC0	Escherichia_phage	81.0	1.7e-108
AVG34241.1|1008901_1009126_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	56.9	1.8e-13
AVG34242.1|1009122_1009269_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	81.2	5.6e-19
AVG37734.1|1009276_1009525_+	excisionase	NA	S4TND0	Salmonella_phage	88.9	7.7e-37
AVG34243.1|1009569_1010862_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	95.8	1.7e-244
AVG34244.1|1011046_1012249_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.6	1.3e-44
AVG34245.1|1012415_1013816_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	36.6	5.5e-79
AVG34246.1|1014188_1014377_+	hypothetical protein	NA	NA	NA	NA	NA
AVG34247.1|1014421_1015528_+	porin	NA	Q1MVN1	Enterobacteria_phage	52.7	1.9e-98
AVG34248.1|1015712_1016903_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AVG34249.1|1016951_1017599_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVG34250.1|1017619_1018171_-	DUF882 domain-containing protein	NA	NA	NA	NA	NA
AVG34251.1|1018345_1020169_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AVG34252.1|1020347_1024799_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AVG34253.1|1024798_1025503_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
AVG34254.1|1025483_1026806_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AVG34255.1|1026809_1027589_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 79
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1032724	1037277	4876999		Bacillus_phage(100.0%)	3	NA	NA
AVG34262.1|1032724_1034473_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.0	3.0e-58
AVG34263.1|1034509_1036774_-	ComEC family protein	NA	NA	NA	NA	NA
AVG34264.1|1036989_1037277_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
>prophage 80
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1041454	1042543	4876999		Streptococcus_phage(100.0%)	1	NA	NA
AVG34268.1|1041454_1042543_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.7	7.8e-81
>prophage 81
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1046601	1049828	4876999		Tetraselmis_virus(100.0%)	2	NA	NA
AVG34272.1|1046601_1048884_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	3.8e-162
AVG34273.1|1049087_1049828_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	6.1e-21
>prophage 82
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1053425	1069019	4876999	tRNA	Organic_Lake_phycodnavirus(28.57%)	10	NA	NA
AVG34277.1|1053425_1055870_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	1.2e-217
AVG34278.1|1056082_1057375_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	3.6e-93
AVG34279.1|1057467_1058811_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	2.5e-81
AVG34280.1|1058820_1059435_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVG34281.1|1059563_1063274_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	3.5e-88
AVG34282.1|1063409_1063904_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVG34283.1|1064282_1064471_+	hypothetical protein	NA	NA	NA	NA	NA
AVG34284.1|1064448_1065417_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.3	9.4e-62
AVG34285.1|1065531_1067298_+	thiol reductant ABC exporter subunit CydD	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	5.6e-12
AVG34286.1|1067297_1069019_+	thiol reductant ABC exporter subunit CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.1	4.3e-17
>prophage 83
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1072029	1082400	4876999	transposase,protease	Pandoravirus(16.67%)	9	NA	NA
AVG34290.1|1072029_1073583_-	bifunctional metallophosphatase/5'-nucleotidase	NA	S4W5J5	Pandoravirus	24.6	4.6e-18
AVG34291.1|1073741_1073921_+	hypothetical protein	NA	NA	NA	NA	NA
AVG34292.1|1073917_1074172_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34293.1|1074796_1075916_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG34294.1|1076350_1076788_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34295.1|1077272_1079552_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.8e-164
AVG34296.1|1079579_1079900_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	4.5e-13
AVG34297.1|1080167_1080389_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AVG34298.1|1080459_1082400_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	2.5e-37
>prophage 84
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1091884	1093603	4876999		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVG34306.1|1091884_1093603_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
>prophage 85
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1099814	1102583	4876999		Sucra_jujuba_nucleopolyhedrovirus(100.0%)	1	NA	NA
AVG34312.1|1099814_1102583_-	glycoside hydrolase	NA	A0A097P8Z3	Sucra_jujuba_nucleopolyhedrovirus	58.2	4.4e-189
>prophage 86
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1119031	1119760	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG34329.1|1119031_1119760_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	2.3e-28
>prophage 87
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1126061	1141947	4876999		uncultured_Caudovirales_phage(33.33%)	17	NA	NA
AVG34336.1|1126061_1127531_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	3.7e-25
AVG34337.1|1127514_1128222_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	7.1e-35
AVG34338.1|1128294_1129422_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.2	2.5e-29
AVG34339.1|1129462_1129936_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVG34340.1|1130001_1130847_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVG34341.1|1130843_1131797_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AVG34342.1|1131807_1132965_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	8.7e-30
AVG34343.1|1133084_1134197_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVG34344.1|1134548_1135025_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVG34345.1|1135088_1135991_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.9	1.8e-38
AVG34346.1|1136060_1136783_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AVG34347.1|1136967_1137237_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	7.9e-27
AVG34348.1|1137267_1137642_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34349.1|1137915_1139601_+	transporter	NA	NA	NA	NA	NA
AVG34350.1|1139852_1140173_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.9	2.6e-21
AVG34351.1|1140213_1141503_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	1.6e-170
AVG34352.1|1141515_1141947_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.6	6.2e-50
>prophage 88
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1147521	1149583	4876999		Escherichia_phage(50.0%)	2	NA	NA
AVG34359.1|1147521_1148280_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.3	7.4e-14
AVG34360.1|1148377_1149583_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	4.1e-99
>prophage 89
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1157065	1158937	4876999		Bacillus_virus(100.0%)	1	NA	NA
AVG34368.1|1157065_1158937_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G3M9Y6	Bacillus_virus	31.1	6.5e-19
>prophage 90
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1162151	1166279	4876999		Synechococcus_phage(50.0%)	3	NA	NA
AVG34372.1|1162151_1162814_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	32.7	2.4e-24
AVG34373.1|1162942_1163842_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AVG34374.1|1163846_1166279_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	49.1	2.3e-08
>prophage 91
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1173839	1175435	4876999		Tupanvirus(100.0%)	1	NA	NA
AVG34380.1|1173839_1175435_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.4	4.2e-59
>prophage 92
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1178726	1181292	4876999		Pandoravirus(50.0%)	2	NA	NA
AVG34384.1|1178726_1180103_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.2	4.6e-22
AVG34385.1|1180251_1181292_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	34.0	1.6e-06
>prophage 93
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1189585	1196974	4876999		Enterobacteria_phage(20.0%)	8	NA	NA
AVG34393.1|1189585_1190104_-	outer membrane protein OmpX	NA	Q9EV15	Enterobacteria_phage	31.3	1.2e-15
AVG34394.1|1190458_1191346_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVG34395.1|1191645_1192149_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.4	9.3e-05
AVG34396.1|1192599_1193331_-	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	53.3	4.9e-71
AVG34397.1|1193658_1194159_+	hypothetical protein	NA	A0A1D9C9Q4	Salinivibrio_phage	57.2	5.7e-47
AVG34398.1|1194768_1195512_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AVG34399.1|1195595_1196255_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AVG34400.1|1196251_1196974_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.2	1.6e-34
>prophage 94
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1200515	1201171	4876999		Enterobacteria_phage(50.0%)	2	NA	NA
AVG34403.1|1200515_1200782_+	DUF1471 domain-containing protein	NA	A0A142IIN6	Enterobacteria_phage	41.5	4.9e-05
AVG34404.1|1200904_1201171_+	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	51.7	6.4e-13
>prophage 95
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1208407	1215677	4876999		Bacillus_phage(33.33%)	5	NA	NA
AVG34411.1|1208407_1210585_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	2.3e-44
AVG34412.1|1210682_1212068_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	1.3e-51
AVG34413.1|1212275_1212953_+	transcriptional regulator	NA	NA	NA	NA	NA
AVG34414.1|1212949_1213945_+	secretion protein HlyD	NA	NA	NA	NA	NA
AVG34415.1|1213937_1215677_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	1.4e-20
>prophage 96
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1225311	1226220	4876999		Streptococcus_phage(100.0%)	1	NA	NA
AVG34428.1|1225311_1226220_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	30.1	4.1e-27
>prophage 97
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1233441	1236893	4876999		Klosneuvirus(50.0%)	3	NA	NA
AVG34435.1|1233441_1234749_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.8	2.7e-19
AVG34436.1|1234797_1235274_+	kinase inhibitor	NA	NA	NA	NA	NA
AVG34437.1|1235372_1236893_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.2	4.0e-83
>prophage 98
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1245645	1254112	4876999	transposase	Leptospira_phage(25.0%)	9	NA	NA
AVG34445.1|1245645_1246766_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG34446.1|1246935_1247586_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
AVG34447.1|1247586_1248645_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	32.5	1.1e-18
AVG34448.1|1248647_1249337_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVG34449.1|1249336_1250110_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG37740.1|1250288_1250438_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AVG34450.1|1250565_1251354_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVG34451.1|1251421_1252894_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	31.9	2.6e-10
AVG34452.1|1253095_1254112_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	4.0e-79
>prophage 99
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1258375	1261874	4876999		Edwardsiella_phage(33.33%)	4	NA	NA
AVG34457.1|1258375_1259428_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.0e-82
AVG34458.1|1259732_1260113_+	hypothetical protein	NA	NA	NA	NA	NA
AVG34459.1|1260219_1261158_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	8.9e-25
AVG34460.1|1261154_1261874_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.5	9.8e-24
>prophage 100
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1290826	1291618	4876999		Kaumoebavirus(100.0%)	1	NA	NA
AVG34485.1|1290826_1291618_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.8	1.3e-08
>prophage 101
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1294715	1300871	4876999		Hokovirus(50.0%)	5	NA	NA
AVG34489.1|1294715_1296128_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.5	9.8e-60
AVG34490.1|1296519_1296726_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVG34491.1|1297035_1297125_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVG34492.1|1297124_1298804_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AVG34493.1|1298822_1300871_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	1.4e-27
>prophage 102
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1304143	1304821	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG34496.1|1304143_1304821_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	29.7	5.8e-26
>prophage 103
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1316441	1318109	4876999	tRNA	Escherichia_phage(100.0%)	1	NA	NA
AVG34507.1|1316441_1318109_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.0	0.0e+00
>prophage 104
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1324910	1326575	4876999		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVG34513.1|1324910_1326575_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	2.1e-85
>prophage 105
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1330504	1331551	4876999		Pseudomonas_phage(100.0%)	1	NA	NA
AVG34516.1|1330504_1331551_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.4e-48
>prophage 106
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1337354	1342482	4876999	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
AVG34522.1|1337354_1338080_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	2.1e-29
AVG34523.1|1338200_1339139_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AVG37744.1|1339202_1339685_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34524.1|1339875_1342482_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.0	3.8e-182
>prophage 107
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1348874	1351338	4876999		Synechococcus_phage(50.0%)	2	NA	NA
AVG34531.1|1348874_1349987_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.4e-08
AVG34532.1|1350126_1351338_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	5.8e-101
>prophage 108
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1356128	1356971	4876999		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVG34539.1|1356128_1356512_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.2	6.8e-24
AVG34540.1|1356731_1356971_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	8.0e-23
>prophage 109
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1363358	1369608	4876999		Morganella_phage(25.0%)	6	NA	NA
AVG34547.1|1363358_1363787_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	36.4	4.0e-17
AVG34548.1|1363847_1365413_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.3	5.4e-43
AVG34549.1|1365600_1366164_-	peroxiredoxin	NA	NA	NA	NA	NA
AVG34550.1|1366787_1367687_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG34551.1|1367773_1368997_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.7	5.0e-60
AVG34552.1|1368981_1369608_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	49.2	2.1e-54
>prophage 110
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1379212	1383629	4876999		Staphylococcus_phage(50.0%)	5	NA	NA
AVG34563.1|1379212_1380715_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	1.3e-17
AVG34564.1|1380874_1381963_+	oxidoreductase	NA	NA	NA	NA	NA
AVG34565.1|1382020_1382764_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
AVG34566.1|1382947_1383253_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AVG34567.1|1383224_1383629_+	XRE family transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	3.0e-06
>prophage 111
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1395542	1400289	4876999		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AVG34578.1|1395542_1396343_+	iron-enterobactin transporter ATP-binding protein	NA	M1I1A6	Acanthocystis_turfacea_Chlorella_virus	25.5	2.9e-08
AVG34579.1|1396431_1400289_-	enterobactin synthase subunit F	NA	A0A2K9KZV5	Tupanvirus	28.7	9.8e-62
>prophage 112
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1404981	1410910	4876999	holin	Vibrio_phage(50.0%)	5	NA	NA
AVG34584.1|1404981_1407015_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.3	9.9e-21
AVG37747.1|1407011_1407227_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34585.1|1407143_1407731_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AVG34586.1|1407744_1409217_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVG34587.1|1409230_1410910_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	8.9e-60
>prophage 113
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1418167	1419695	4876999		Planktothrix_phage(100.0%)	2	NA	NA
AVG34595.1|1418167_1419004_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	1.1e-15
AVG34596.1|1418990_1419695_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	2.4e-22
>prophage 114
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1428966	1433223	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG34606.1|1428966_1433223_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	52.7	8.4e-30
>prophage 115
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1444052	1446761	4876999		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVG34616.1|1444052_1446761_-	carbonate dehydratase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.5	1.9e-67
>prophage 116
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1451493	1454106	4876999		Moraxella_phage(100.0%)	1	NA	NA
AVG34621.1|1451493_1454106_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	37.3	3.8e-33
>prophage 117
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1463997	1465029	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG34629.1|1463997_1465029_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	1.6e-22
>prophage 118
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1478548	1479415	4876999		Enterococcus_phage(100.0%)	1	NA	NA
AVG34642.1|1478548_1479415_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.5	6.5e-30
>prophage 119
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1483194	1484580	4876999	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVG34647.1|1483194_1484580_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	33.2	6.3e-43
>prophage 120
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1493329	1494016	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG37750.1|1493329_1494016_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.1e-32
>prophage 121
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1497146	1503235	4876999		Bacillus_virus(50.0%)	6	NA	NA
AVG34660.1|1497146_1497818_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	4.5e-23
AVG34661.1|1497961_1498813_+	hypothetical protein	NA	NA	NA	NA	NA
AVG34662.1|1498857_1499772_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AVG34663.1|1499768_1500221_+	NfeD family protein	NA	NA	NA	NA	NA
AVG34664.1|1500217_1500628_-	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AVG34665.1|1500736_1503235_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.4	2.2e-110
>prophage 122
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1513202	1518747	4876999		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
AVG34674.1|1513202_1515077_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.9	1.1e-111
AVG34675.1|1515187_1515793_-	recombination protein RecR	NA	NA	NA	NA	NA
AVG34676.1|1515792_1516125_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVG34677.1|1516178_1518107_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.0	4.3e-42
AVG34678.1|1518195_1518747_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	1.6e-29
>prophage 123
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1525549	1532602	4876999		Leptospira_phage(50.0%)	6	NA	NA
AVG34684.1|1525549_1528696_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.6	3.4e-52
AVG34685.1|1529207_1529582_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
AVG34686.1|1529609_1529828_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AVG34687.1|1530033_1530585_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AVG34688.1|1530702_1531170_+	hypothetical protein	NA	NA	NA	NA	NA
AVG34689.1|1531141_1532602_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.3	2.0e-15
>prophage 124
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1536885	1541148	4876999		Herpes_simplex_virus(50.0%)	2	NA	NA
AVG34696.1|1536885_1539975_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	65.6	0.0e+00
AVG37752.1|1540077_1541148_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	55.0	1.3e-91
>prophage 125
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1548330	1551877	4876999		Bacillus_phage(100.0%)	2	NA	NA
AVG34706.1|1548330_1550112_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	4.0e-42
AVG34707.1|1550104_1551877_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.2e-50
>prophage 126
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1556255	1556951	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG34711.1|1556255_1556951_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	2.1e-87
>prophage 127
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1560123	1565169	4876999	protease	Sodalis_phage(25.0%)	4	NA	NA
AVG34715.1|1560123_1560396_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
AVG34716.1|1560606_1562961_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	5.5e-225
AVG34717.1|1563144_1564419_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	3.0e-132
AVG34718.1|1564545_1565169_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.4	2.9e-64
>prophage 128
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1586005	1587667	4876999		Staphylococcus_phage(50.0%)	2	NA	NA
AVG34738.1|1586005_1586476_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	1.0e-29
AVG34739.1|1586563_1587667_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.0	4.5e-52
>prophage 129
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1591289	1595629	4876999	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AVG34744.1|1591289_1592261_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.5	1.5e-46
AVG34745.1|1592271_1594119_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVG34746.1|1594146_1594479_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AVG34747.1|1594501_1595629_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.2e-89
>prophage 130
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1607821	1616448	4876999		Bacillus_phage(60.0%)	6	NA	NA
AVG34757.1|1607821_1609117_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	5.9e-27
AVG34758.1|1609138_1609828_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	38.0	5.7e-37
AVG34759.1|1610015_1611221_+	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	25.3	8.8e-09
AVG34760.1|1611217_1614349_+	exonuclease subunit SbcC	NA	M1U9H5	Synechococcus_phage	30.1	2.3e-08
AVG34761.1|1614504_1615410_-	fructokinase	NA	NA	NA	NA	NA
AVG34762.1|1615533_1616448_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.1	3.7e-100
>prophage 131
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1620054	1621158	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG34769.1|1620054_1621158_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	29.7	5.7e-15
>prophage 132
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1630890	1632051	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG34781.1|1630890_1632051_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.0	9.7e-05
>prophage 133
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1640571	1641339	4876999		Bacillus_virus(100.0%)	1	NA	NA
AVG34788.1|1640571_1641339_-	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	39.6	1.2e-40
>prophage 134
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1646897	1700034	4876999	head,terminase,holin,transposase,integrase,tail	Salmonella_phage(38.1%)	73	1642823:1642843	1704173:1704193
1642823:1642843	attL	CCCTCACCCCAGCCCTCTCCC	NA	NA	NA	NA
AVG34793.1|1646897_1648682_+	HAMP domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.9	7.6e-17
AVG34794.1|1648713_1649223_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34795.1|1649239_1650139_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG34796.1|1650248_1651454_+	hypothetical protein	NA	NA	NA	NA	NA
AVG34797.1|1651598_1652522_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AVG34798.1|1652565_1652841_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	93.0	1.7e-37
AVG34799.1|1652991_1654083_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	32.7	1.8e-32
AVG34800.1|1654136_1654610_-|tail	tail assembly chaperone	tail	K7PMH7	Enterobacteria_phage	45.0	1.4e-10
AVG34801.1|1654611_1655976_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	54.3	1.7e-40
AVG34802.1|1655979_1656636_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	58.1	2.9e-67
AVG34803.1|1656632_1657829_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	63.9	1.9e-133
AVG34804.1|1657829_1658183_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	1.1e-44
AVG34805.1|1658186_1658825_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	48.8	2.2e-59
AVG34806.1|1658891_1659614_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34807.1|1659621_1660686_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	67.4	1.9e-140
AVG34808.1|1660688_1660994_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	53.5	9.2e-24
AVG34809.1|1660995_1661598_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	70.1	5.6e-65
AVG34810.1|1661597_1663679_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	56.6	2.5e-205
AVG37756.1|1663668_1663797_-	lytic transglycosylase	NA	NA	NA	NA	NA
AVG34811.1|1663856_1664282_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	1.6e-37
AVG34812.1|1664285_1664726_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
AVG34813.1|1664736_1665897_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.9e-157
AVG34814.1|1665900_1666464_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	9.9e-80
AVG34815.1|1666438_1666828_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	96.1	9.5e-66
AVG34816.1|1666814_1667369_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	87.0	2.1e-82
AVG34817.1|1667365_1667773_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	2.3e-70
AVG34818.1|1667738_1668128_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	54.3	5.1e-27
AVG34819.1|1668169_1669111_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	95.5	9.8e-173
AVG34820.1|1669122_1669626_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	83.2	9.4e-74
AVG34821.1|1669630_1670863_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	96.6	5.7e-221
AVG37757.1|1670877_1671582_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	95.0	2.8e-108
AVG34822.1|1671499_1672969_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	95.5	2.1e-270
AVG34823.1|1672968_1674372_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.6	6.1e-187
AVG34824.1|1674295_1675051_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	34.0	6.1e-16
AVG34825.1|1675107_1675293_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34826.1|1675273_1675543_-	hypothetical protein	NA	Q8SBD8	Shigella_phage	68.4	3.4e-22
AVG34827.1|1675436_1675829_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	75.8	1.5e-47
AVG34828.1|1675825_1676440_-	endolysin	NA	A0A192Y6G4	Salmonella_phage	91.2	5.0e-101
AVG34829.1|1676436_1676769_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	55.7	1.5e-22
AVG34830.1|1676842_1677457_-	methyltransferase domain-containing protein	NA	H2BDB7	Pseudomonas_virus	48.7	8.3e-48
AVG34831.1|1677362_1678304_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	49.5	3.6e-74
AVG34832.1|1678297_1678849_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	47.5	1.9e-43
AVG34833.1|1678991_1679675_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	44.1	2.9e-41
AVG34834.1|1679671_1680031_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	76.3	9.8e-49
AVG34835.1|1680027_1680327_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	87.9	1.9e-42
AVG34836.1|1680316_1680769_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	53.1	3.4e-38
AVG34837.1|1681009_1681348_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	85.7	4.9e-50
AVG34838.1|1681340_1681742_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	74.2	3.3e-45
AVG34839.1|1681734_1682367_-	DUF551 domain-containing protein	NA	C6ZR26	Salmonella_phage	73.8	2.1e-09
AVG34840.1|1682370_1682559_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34841.1|1682558_1683263_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	48.6	8.1e-23
AVG34842.1|1683423_1683906_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.2	8.5e-72
AVG34843.1|1683902_1684193_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	64.5	1.4e-29
AVG34844.1|1684192_1685590_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	64.0	7.4e-169
AVG34845.1|1685586_1686411_-	DNA replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	43.0	1.0e-48
AVG34846.1|1686640_1686895_-	hypothetical protein	NA	NA	NA	NA	NA
AVG34847.1|1686898_1687219_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	88.7	2.9e-44
AVG34848.1|1687254_1687485_-	transcriptional regulator	NA	A0A2D1GLN0	Escherichia_phage	74.7	1.4e-24
AVG37758.1|1687592_1688288_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	69.3	1.1e-91
AVG34849.1|1688325_1688523_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	55.4	8.9e-12
AVG34850.1|1688742_1688943_+	hypothetical protein	NA	NA	NA	NA	NA
AVG34851.1|1688942_1689140_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVG34852.1|1689150_1689423_+	hypothetical protein	NA	S4TU79	Salmonella_phage	56.7	3.3e-25
AVG34853.1|1689656_1690328_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.6	1.6e-15
AVG34854.1|1690324_1690996_+	ATP-binding protein	NA	G9L667	Escherichia_phage	45.7	9.7e-50
AVG34855.1|1691012_1691699_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.3	7.7e-26
AVG34856.1|1691710_1691869_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	52.9	2.4e-07
AVG34857.1|1691865_1694436_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	48.2	2.8e-222
AVG37759.1|1694438_1694678_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	88.6	1.9e-32
AVG34858.1|1694943_1696107_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	67.5	9.6e-154
AVG34859.1|1696308_1697562_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	1.1e-97
AVG34860.1|1697573_1698677_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	5.9e-60
AVG34861.1|1698981_1700034_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	1.0e-117
1704173:1704193	attR	CCCTCACCCCAGCCCTCTCCC	NA	NA	NA	NA
>prophage 135
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1713382	1713961	4876999		Caulobacter_phage(100.0%)	1	NA	NA
AVG34877.1|1713382_1713961_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.2	3.3e-14
>prophage 136
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1722597	1730198	4876999		Bacillus_virus(20.0%)	8	NA	NA
AVG34883.1|1722597_1723680_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.6e-14
AVG34884.1|1723676_1724690_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	3.7e-16
AVG34885.1|1724686_1725406_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
AVG34886.1|1725994_1726735_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	3.8e-39
AVG34887.1|1726790_1727258_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	57.8	8.8e-50
AVG34888.1|1727254_1727974_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVG34889.1|1728006_1728765_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVG34890.1|1728833_1730198_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	9.9e-09
>prophage 137
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1734253	1735057	4876999		Indivirus(100.0%)	1	NA	NA
AVG34894.1|1734253_1735057_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	8.4e-40
>prophage 138
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1741550	1742582	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG34896.1|1741550_1742582_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	4.2e-36
>prophage 139
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1754555	1758673	4876999		Saccharomonospora_phage(50.0%)	2	NA	NA
AVG34911.1|1754555_1758038_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	2.9e-206
AVG34912.1|1758076_1758673_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.4	2.1e-27
>prophage 140
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1767493	1768252	4876999		Flavobacterium_phage(100.0%)	1	NA	NA
AVG34921.1|1767493_1768252_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 141
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1779634	1781071	4876999	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVG34931.1|1779634_1781071_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.5	7.2e-26
>prophage 142
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1785035	1785383	4876999		Lake_Baikal_phage(100.0%)	1	NA	NA
AVG34936.1|1785035_1785383_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.7e-26
>prophage 143
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1791283	1792081	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG34941.1|1791283_1792081_-	iron-hydroxamate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	27.0	9.2e-15
>prophage 144
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1797286	1804060	4876999	tRNA	Bodo_saltans_virus(50.0%)	6	NA	NA
AVG34944.1|1797286_1799716_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	30.3	1.9e-39
AVG34945.1|1799789_1800344_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AVG34946.1|1800333_1801038_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVG34947.1|1801214_1801670_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AVG34948.1|1801729_1802620_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVG34949.1|1802635_1804060_+	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	36.1	6.1e-25
>prophage 145
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1809352	1815977	4876999		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
AVG34957.1|1809352_1810279_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.3	5.3e-22
AVG34958.1|1810386_1811049_+	carbonate dehydratase	NA	NA	NA	NA	NA
AVG34959.1|1811140_1811677_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	34.0	4.6e-18
AVG34960.1|1811885_1814276_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AVG34961.1|1814408_1815977_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	56.5	1.1e-19
>prophage 146
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1824256	1825681	4876999		Erysipelothrix_phage(100.0%)	1	NA	NA
AVG37766.1|1824256_1825681_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	3.5e-41
>prophage 147
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1837324	1838305	4876999	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVG34975.1|1837324_1838305_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
>prophage 148
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1842586	1843630	4876999		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVG34981.1|1842586_1843630_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.6	4.8e-104
>prophage 149
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1869587	1871312	4876999		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVG35006.1|1869587_1871312_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.2	8.6e-34
>prophage 150
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1885808	1886510	4876999		Planktothrix_phage(100.0%)	1	NA	NA
AVG35020.1|1885808_1886510_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	32.7	1.3e-20
>prophage 151
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1892703	1898096	4876999		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
AVG35026.1|1892703_1895061_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	26.5	1.2e-30
AVG35027.1|1895189_1898096_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	35.9	3.2e-20
>prophage 152
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1905732	1907100	4876999		Acinetobacter_phage(50.0%)	2	NA	NA
AVG35035.1|1905732_1906581_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A1J0MGN8	Acinetobacter_phage	43.8	3.7e-06
AVG35036.1|1906620_1907100_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	2.6e-28
>prophage 153
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1913321	1914470	4876999		Halovirus(100.0%)	1	NA	NA
AVG35042.1|1913321_1914470_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	5.4e-48
>prophage 154
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1917904	1931716	4876999	tRNA	Tupanvirus(20.0%)	11	NA	NA
AVG35047.1|1917904_1920721_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.5	2.6e-80
AVG35048.1|1920766_1921693_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AVG35049.1|1922020_1922284_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AVG35050.1|1922341_1923241_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
AVG35051.1|1923299_1924475_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	55.5	1.2e-84
AVG35052.1|1924646_1925780_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	33.5	5.9e-23
AVG35053.1|1925867_1927781_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.0	2.9e-147
AVG35054.1|1928077_1928644_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35055.1|1928620_1929943_-	MFS transporter	NA	NA	NA	NA	NA
AVG35056.1|1930064_1930652_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AVG35057.1|1930762_1931716_-	transaldolase	NA	A0A127KMN5	Cyanophage	32.2	4.3e-11
>prophage 155
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1945192	1952455	4876999		Bacillus_phage(33.33%)	5	NA	NA
AVG35072.1|1945192_1947130_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	1.4e-11
AVG35073.1|1947357_1949025_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.1e-41
AVG35074.1|1949116_1950016_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG35075.1|1950124_1951126_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AVG35076.1|1951222_1952455_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.1	1.3e-87
>prophage 156
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1958889	1960212	4876999		Geobacillus_virus(100.0%)	1	NA	NA
AVG35083.1|1958889_1960212_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	5.7e-78
>prophage 157
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1965692	1968488	4876999		Salmonella_phage(50.0%)	3	NA	NA
AVG35088.1|1965692_1965872_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	2.5e-13
AVG35089.1|1965981_1966599_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVG35090.1|1966898_1968488_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.5	8.2e-31
>prophage 158
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1981340	1982620	4876999		Salmonella_phage(50.0%)	2	NA	NA
AVG35105.1|1981340_1981886_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	52.1	1.6e-21
AVG35106.1|1981882_1982620_+	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	48.1	1.9e-62
>prophage 159
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	1993544	1995209	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG37774.1|1993544_1995209_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	9.9e-11
>prophage 160
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2018554	2020174	4876999		Bodo_saltans_virus(100.0%)	1	NA	NA
AVG35139.1|2018554_2020174_+	SAM-dependent DNA methyltransferase	NA	A0A2H4UVW8	Bodo_saltans_virus	26.2	1.9e-06
>prophage 161
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2024510	2025434	4876999	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVG37775.1|2024510_2025434_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
>prophage 162
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2041579	2049046	4876999	protease	Bacillus_virus(50.0%)	4	NA	NA
AVG35159.1|2041579_2042182_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	G3M9Z8	Bacillus_virus	39.2	9.4e-28
AVG35160.1|2042270_2042657_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AVG35161.1|2042842_2043460_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG35162.1|2043463_2049046_-	GHKL domain-containing protein	NA	Q67624	IC4_retrovirus	34.3	1.3e-09
>prophage 163
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2054829	2055651	4876999		Mycobacterium_phage(100.0%)	1	NA	NA
AVG35170.1|2054829_2055651_+	alpha/beta hydrolase	NA	A0A249XMC3	Mycobacterium_phage	28.8	1.9e-15
>prophage 164
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2063726	2068338	4876999	transposase	Escherichia_phage(50.0%)	5	NA	NA
AVG35177.1|2063726_2064650_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AVG35178.1|2064735_2065152_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVG37777.1|2065267_2065639_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35179.1|2065717_2066191_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
AVG35180.1|2067218_2068338_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 165
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2073781	2079014	4876999		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
AVG35187.1|2073781_2075341_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	1.1e-11
AVG35188.1|2075678_2077199_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	48.5	1.1e-32
AVG35189.1|2077607_2079014_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.8e-33
>prophage 166
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2085498	2086986	4876999		Staphylococcus_phage(100.0%)	1	NA	NA
AVG35198.1|2085498_2086986_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	8.8e-19
>prophage 167
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2095039	2096008	4876999		Escherichia_phage(100.0%)	1	NA	NA
AVG35205.1|2095039_2096008_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.5	4.4e-35
>prophage 168
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2110744	2113039	4876999		Tetraselmis_virus(100.0%)	1	NA	NA
AVG35223.1|2110744_2113039_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.3	1.4e-156
>prophage 169
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2132799	2140614	4876999		Streptococcus_phage(25.0%)	10	NA	NA
AVG35239.1|2132799_2133663_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.8	9.6e-50
AVG35240.1|2133725_2135870_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVG35241.1|2135827_2136223_+	YraN family protein	NA	NA	NA	NA	NA
AVG35242.1|2136244_2136835_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.8	4.1e-12
AVG35243.1|2136844_2137420_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVG35244.1|2137486_2138524_-	permease	NA	NA	NA	NA	NA
AVG35245.1|2138564_2139209_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35246.1|2139337_2139856_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.7	2.0e-10
AVG35247.1|2139835_2140270_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35248.1|2140284_2140614_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	48.7	8.8e-12
>prophage 170
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2146250	2148146	4876999		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVG35254.1|2146250_2148146_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	2.4e-53
>prophage 171
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2153690	2165353	4876999	protease	Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
AVG35261.1|2153690_2156378_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
AVG35262.1|2156402_2157905_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AVG35263.1|2157933_2158398_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AVG35264.1|2158957_2160304_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	8.2e-64
AVG35265.1|2160585_2160918_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AVG35266.1|2161141_2162479_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AVG35267.1|2162471_2163320_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	32.2	7.5e-23
AVG35268.1|2163418_2165353_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	7.0e-117
>prophage 172
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2168795	2170498	4876999		Bacillus_phage(100.0%)	2	NA	NA
AVG35273.1|2168795_2169458_+	two-component system response regulator BasR	NA	W8CYM9	Bacillus_phage	37.2	3.8e-30
AVG35274.1|2169454_2170498_+	two-component system sensor histidine kinase BasS	NA	W8CYF6	Bacillus_phage	23.0	1.5e-12
>prophage 173
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2173632	2175121	4876999		Indivirus(50.0%)	2	NA	NA
AVG35279.1|2173632_2174604_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.7	1.6e-08
AVG35280.1|2174833_2175121_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	68.3	2.3e-16
>prophage 175
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2215510	2216008	4876999	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AVG37783.1|2215510_2216008_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	56.7	5.0e-27
>prophage 176
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2219973	2221341	4876999	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVG35321.1|2219973_2221341_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.4	3.5e-22
>prophage 177
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2240607	2241651	4876999		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVG35338.1|2240607_2241651_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 178
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2254891	2256973	4876999		Bacillus_virus(100.0%)	1	NA	NA
AVG35353.1|2254891_2256973_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	35.9	4.1e-22
>prophage 179
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2263257	2267411	4876999		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVG35358.1|2263257_2264283_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	40.0	6.2e-72
AVG35359.1|2264350_2265532_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVG35360.1|2265541_2266645_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG35361.1|2266652_2267411_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	2.0e-19
>prophage 180
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2274824	2279150	4876999	tRNA	Pandoravirus(33.33%)	6	NA	NA
AVG35365.1|2274824_2275397_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.1	1.4e-09
AVG35366.1|2275389_2275944_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35367.1|2275970_2276444_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AVG37786.1|2276415_2277540_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVG35368.1|2277667_2278177_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	3.3e-18
AVG35369.1|2278202_2279150_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.0	1.9e-06
>prophage 181
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2299035	2302404	4876999		Tupanvirus(50.0%)	2	NA	NA
AVG35406.1|2299035_2300220_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.8	4.4e-13
AVG35407.1|2300289_2302404_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	4.7e-58
>prophage 182
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2310363	2319946	4876999		Tupanvirus(25.0%)	9	NA	NA
AVG35420.1|2310363_2312268_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.7	3.8e-75
AVG35421.1|2312380_2313403_+	hydrolase	NA	NA	NA	NA	NA
AVG35422.1|2313399_2313618_+	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.7	5.2e-05
AVG35423.1|2313648_2314518_+	phosphoribulokinase	NA	NA	NA	NA	NA
AVG35424.1|2314584_2314989_-	OsmC family protein	NA	NA	NA	NA	NA
AVG35425.1|2315300_2315933_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVG35426.1|2315990_2318078_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	87.0	5.1e-65
AVG35427.1|2318074_2319310_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVG35428.1|2319382_2319946_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.1	7.1e-62
>prophage 183
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2331566	2332379	4876999		Vibrio_phage(100.0%)	1	NA	NA
AVG35440.1|2331566_2332379_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.5	2.1e-70
>prophage 184
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2347286	2351132	4876999		Bacillus_phage(66.67%)	3	NA	NA
AVG35455.1|2347286_2348906_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.1	3.2e-139
AVG35456.1|2349069_2350416_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	8.6e-13
AVG35457.1|2350412_2351132_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 185
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2363773	2366167	4876999		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVG35469.1|2363773_2366167_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	6.8e-13
>prophage 186
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2369557	2370316	4876999		Escherichia_phage(100.0%)	1	NA	NA
AVG35471.1|2369557_2370316_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.1	2.0e-22
>prophage 187
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2373397	2375845	4876999		Dickeya_phage(100.0%)	1	NA	NA
AVG35475.1|2373397_2375845_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	2.1e-33
>prophage 188
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2384956	2386032	4876999		Dickeya_phage(50.0%)	2	NA	NA
AVG35481.1|2384956_2385199_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	7.9e-10
AVG35482.1|2385366_2386032_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	6.7e-59
>prophage 189
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2408342	2417640	4876999		Tupanvirus(40.0%)	9	NA	NA
AVG35508.1|2408342_2410325_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	1.1e-19
AVG35509.1|2410321_2411305_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.4	3.4e-35
AVG35510.1|2411306_2412446_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	31.3	1.6e-31
AVG35511.1|2412772_2413276_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
AVG35512.1|2413375_2414257_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG35513.1|2414289_2415084_+	KR domain-containing protein	NA	NA	NA	NA	NA
AVG35514.1|2415089_2415617_-	glycoside hydrolase	NA	S5MM68	Bacillus_phage	33.6	6.7e-14
AVG35515.1|2415856_2416519_+	HAD family hydrolase	NA	NA	NA	NA	NA
AVG35516.1|2416614_2417640_-	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	46.8	6.0e-75
>prophage 190
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2420802	2425535	4876999		Bacillus_phage(50.0%)	5	NA	NA
AVG35520.1|2420802_2421495_+	methyltransferase	NA	E3T536	Cafeteria_roenbergensis_virus	34.5	2.8e-07
AVG35521.1|2421494_2422433_+	3-phosphoglycerate dehydrogenase	NA	A0A1M7XU89	Cedratvirus	32.6	9.8e-32
AVG35522.1|2422805_2423240_-	copper-binding protein	NA	NA	NA	NA	NA
AVG35523.1|2423457_2424858_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AVG35524.1|2424854_2425535_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 191
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2430615	2431353	4876999		Listeria_phage(100.0%)	1	NA	NA
AVG35530.1|2430615_2431353_+	peptidase M23	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
>prophage 192
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2441255	2497142	4876999	transposase,integrase	Macacine_betaherpesvirus(17.39%)	48	2447291:2447308	2455363:2455380
AVG35537.1|2441255_2441936_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AVG35538.1|2441928_2443404_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.7	1.8e-27
AVG35539.1|2443654_2444086_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AVG35540.1|2444229_2444580_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
AVG37790.1|2444967_2445876_-	HNH endonuclease	NA	NA	NA	NA	NA
AVG35541.1|2446328_2447252_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	3.4e-170
2447291:2447308	attL	GATTTATTCAACAAAGCC	NA	NA	NA	NA
AVG35542.1|2447490_2447604_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AVG35543.1|2447972_2448713_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AVG35544.1|2449409_2450420_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
AVG35545.1|2451160_2452327_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AVG35546.1|2452326_2453298_+	ParB/RepB/Spo0J family partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	1.4e-150
AVG35547.1|2454116_2454386_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35548.1|2454378_2455248_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	91.7	9.4e-154
AVG35549.1|2456056_2456584_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
2455363:2455380	attR	GATTTATTCAACAAAGCC	NA	NA	NA	NA
AVG35550.1|2456607_2457132_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35551.1|2457512_2459540_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
AVG35552.1|2459536_2460844_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVG35553.1|2460844_2464102_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AVG35554.1|2464106_2465375_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	8.8e-60
AVG37791.1|2466134_2466899_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVG35555.1|2467124_2467910_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG35556.1|2467914_2468889_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AVG35557.1|2468901_2469714_+	ribokinase	NA	NA	NA	NA	NA
AVG35558.1|2471688_2472840_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.7e-41
AVG35559.1|2472759_2473110_-	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	6.9e-39
AVG35560.1|2473438_2474359_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
AVG35561.1|2474321_2477702_-	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.8	5.8e-34
AVG37792.1|2478006_2479197_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG35562.1|2479253_2480180_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
AVG35563.1|2480189_2481305_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
AVG35564.1|2481301_2482051_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
AVG35565.1|2482061_2482751_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	5.9e-18
AVG35566.1|2482786_2483794_+	formamidase	NA	NA	NA	NA	NA
AVG35567.1|2484958_2485975_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	98.8	5.0e-183
AVG35568.1|2486013_2486136_-	ABC transporter	NA	NA	NA	NA	NA
AVG35569.1|2487098_2487821_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	31.5	6.6e-28
AVG35570.1|2488311_2489583_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	9.5e-155
AVG35571.1|2489582_2490014_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	6.1e-29
AVG35572.1|2490243_2491218_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	47.1	2.4e-73
AVG35573.1|2491220_2491883_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AVG35574.1|2491886_2492150_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35575.1|2492178_2492382_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37793.1|2492754_2493222_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35576.1|2493758_2494451_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.3	8.3e-28
AVG35577.1|2494447_2494669_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35578.1|2494724_2495147_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVG35579.1|2495349_2495985_-	peptidase	NA	NA	NA	NA	NA
AVG35580.1|2496170_2497142_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.2	5.0e-23
>prophage 193
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2504459	2616177	4876999	transposase,protease,integrase	Escherichia_phage(20.0%)	108	2530117:2530133	2558558:2558574
AVG35591.1|2504459_2505828_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
AVG35592.1|2506005_2507346_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG35593.1|2507601_2508012_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35594.1|2508185_2509316_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AVG35595.1|2509328_2509598_-	metal resistance protein	NA	NA	NA	NA	NA
AVG35596.1|2509703_2511002_-	MFS transporter	NA	NA	NA	NA	NA
AVG35597.1|2511235_2511994_-	Tat pathway signal sequence	NA	NA	NA	NA	NA
AVG35598.1|2512047_2512968_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35599.1|2513030_2513402_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35600.1|2513802_2514726_+	chromate resistance protein	NA	NA	NA	NA	NA
AVG35601.1|2514679_2516059_+	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.6	1.6e-27
AVG35602.1|2516089_2516779_-	transmembrane anchor protein	NA	NA	NA	NA	NA
AVG35603.1|2516792_2517530_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35604.1|2517573_2517939_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35605.1|2518189_2518429_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	9.1e-19
AVG35606.1|2518428_2518716_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AVG35607.1|2518787_2518946_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AVG35608.1|2519824_2520139_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35609.1|2520198_2520660_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35610.1|2520749_2520950_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35611.1|2520990_2521782_+	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	36.1	1.7e-13
AVG35612.1|2521824_2522160_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37795.1|2522849_2523143_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35613.1|2523159_2523981_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	42.9	3.1e-50
AVG35614.1|2524009_2524549_-	lytic transglycosylase	NA	NA	NA	NA	NA
AVG35615.1|2526813_2527812_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
AVG37796.1|2527885_2529649_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AVG35616.1|2529676_2530465_+	DsbA family protein	NA	NA	NA	NA	NA
2530117:2530133	attL	TCAGGCTGCGCAGCAGG	NA	NA	NA	NA
AVG35617.1|2530622_2530850_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AVG35618.1|2530876_2531212_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AVG35619.1|2531821_2532811_-|integrase	integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.7	1.0e-47
AVG35620.1|2534372_2534777_-	DNA-binding protein	NA	NA	NA	NA	NA
AVG35621.1|2535371_2535860_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AVG35622.1|2535862_2537086_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AVG35623.1|2537096_2538053_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
AVG35624.1|2538052_2539132_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	35.3	5.6e-39
AVG35625.1|2539133_2539907_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35626.1|2539899_2541042_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	1.6e-31
AVG35627.1|2541050_2542109_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AVG35628.1|2542435_2543017_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	2.0e-11
AVG35629.1|2543016_2544186_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AVG35630.1|2544208_2544664_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AVG35631.1|2544687_2545728_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.7	2.5e-76
AVG35632.1|2545776_2546355_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.8	3.0e-31
AVG35633.1|2546424_2547000_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.8	8.7e-31
AVG35634.1|2547059_2547710_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35635.1|2547726_2548980_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
AVG35636.1|2549595_2549940_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35637.1|2549930_2551034_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35638.1|2551210_2552191_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AVG35639.1|2552630_2552915_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVG35640.1|2552911_2553766_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	8.0e-81
AVG35641.1|2554365_2554794_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AVG35642.1|2554987_2555983_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.6	1.4e-20
AVG35643.1|2556827_2557979_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
AVG35644.1|2558003_2558951_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
2558558:2558574	attR	TCAGGCTGCGCAGCAGG	NA	NA	NA	NA
AVG35645.1|2558928_2559426_-	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AVG35646.1|2559428_2561138_-	sodium:proton exchanger	NA	NA	NA	NA	NA
AVG35647.1|2561141_2561582_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	37.2	4.5e-11
AVG35648.1|2561571_2562717_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35649.1|2562796_2563408_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AVG35650.1|2563497_2564385_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35651.1|2564487_2565402_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35652.1|2565424_2565883_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVG37798.1|2565970_2566111_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35653.1|2566859_2567051_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35654.1|2567050_2569900_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.1	2.6e-128
AVG35655.1|2570005_2570575_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVG37797.1|2570609_2570891_-	DNA-binding protein	NA	NA	NA	NA	NA
AVG35656.1|2571132_2571396_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35657.1|2571395_2571650_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35658.1|2571934_2572915_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AVG37799.1|2572953_2573079_-	ABC transporter	NA	NA	NA	NA	NA
AVG35659.1|2574608_2575520_+	acetamidase	NA	NA	NA	NA	NA
AVG35660.1|2575516_2576860_+	amino acid permease	NA	NA	NA	NA	NA
AVG35661.1|2578181_2579282_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
AVG35662.1|2579369_2579615_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35663.1|2579650_2580067_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AVG35664.1|2580063_2580294_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVG35665.1|2582280_2582715_-	copper-binding protein	NA	NA	NA	NA	NA
AVG35666.1|2582930_2584331_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
AVG35667.1|2584327_2585008_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AVG35668.1|2585062_2585992_-	copper resistance protein D	NA	NA	NA	NA	NA
AVG35669.1|2585996_2586377_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AVG35670.1|2586416_2587313_-	copper resistance protein B	NA	NA	NA	NA	NA
AVG35671.1|2587312_2589130_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AVG35672.1|2589294_2590275_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AVG35673.1|2590256_2590667_+	hypothetical protein	NA	A8ATH6	Listeria_phage	51.0	2.4e-06
AVG35674.1|2590700_2590898_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AVG35675.1|2590938_2593398_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.1	1.9e-82
AVG35676.1|2593525_2593966_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35677.1|2594051_2597198_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AVG35678.1|2597208_2598501_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVG35679.1|2598614_2598968_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG35680.1|2598995_2600381_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35681.1|2600570_2601251_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.7e-31
AVG35682.1|2601243_2602725_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
AVG35683.1|2602969_2603401_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AVG35684.1|2603548_2603899_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
AVG35685.1|2604067_2605894_-	OLD family endonuclease	NA	NA	NA	NA	NA
AVG35686.1|2606457_2606757_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVG35687.1|2607109_2607418_-	hypothetical protein	NA	NA	NA	NA	NA
AVG35688.1|2607850_2608774_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AVG35689.1|2609113_2610565_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG35690.1|2610601_2611525_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AVG35691.1|2611776_2613225_-	ATP-binding protein	NA	NA	NA	NA	NA
AVG35692.1|2613224_2615348_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG35693.1|2615334_2616177_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 194
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2622157	2624200	4876999		Indivirus(100.0%)	1	NA	NA
AVG35699.1|2622157_2624200_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.6	4.4e-45
>prophage 195
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2669903	2670518	4876999		Streptococcus_phage(100.0%)	1	NA	NA
AVG35729.1|2669903_2670518_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	34.6	4.3e-20
>prophage 196
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2679247	2685433	4876999		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
AVG35737.1|2679247_2680018_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.9	1.6e-24
AVG35738.1|2680020_2680563_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVG35739.1|2680566_2680821_-	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
AVG35740.1|2680897_2682538_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	C7U092	Ostreococcus_tauri_virus	27.6	6.5e-39
AVG35741.1|2682534_2683140_-	ubiquinone biosynthesis protein UbiJ	NA	NA	NA	NA	NA
AVG35742.1|2683153_2683909_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
AVG35743.1|2683975_2685433_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	52.7	2.0e-07
>prophage 197
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2695036	2696866	4876999		Catovirus(100.0%)	1	NA	NA
AVG35753.1|2695036_2696866_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	9.7e-84
>prophage 198
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2700796	2704657	4876999		Bacillus_phage(50.0%)	3	NA	NA
AVG35759.1|2700796_2702959_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	1.9e-115
AVG35760.1|2703038_2703755_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AVG35761.1|2703754_2704657_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.0	2.0e-18
>prophage 199
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2722420	2726619	4876999		uncultured_marine_virus(33.33%)	4	NA	NA
AVG35778.1|2722420_2723551_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	1.5e-18
AVG35779.1|2723555_2724233_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVG35780.1|2724229_2725492_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.5	6.6e-23
AVG35781.1|2725488_2726619_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.5	1.4e-27
>prophage 200
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2730685	2736003	4876999		Indivirus(33.33%)	4	NA	NA
AVG35785.1|2730685_2731015_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AVG35786.1|2731159_2732428_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	2.8e-42
AVG35787.1|2732434_2733919_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AVG35788.1|2733978_2736003_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	7.6e-114
>prophage 201
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2744002	2745649	4876999		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVG35796.1|2744002_2745649_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	31.9	7.6e-64
>prophage 202
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2755678	2757526	4876999		Acinetobacter_phage(100.0%)	1	NA	NA
AVG35803.1|2755678_2757526_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	28.2	1.7e-11
>prophage 203
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2766686	2767349	4876999		Synechococcus_phage(100.0%)	1	NA	NA
AVG35811.1|2766686_2767349_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	4.9e-30
>prophage 204
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2786285	2790755	4876999		Erwinia_phage(50.0%)	5	NA	NA
AVG35827.1|2786285_2787620_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	29.3	2.4e-44
AVG35828.1|2787688_2788609_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVG35829.1|2788701_2789187_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVG35830.1|2789270_2789510_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
AVG35831.1|2789909_2790755_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	8.9e-16
>prophage 205
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2802611	2806272	4876999		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
AVG35843.1|2802611_2803310_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AVG35844.1|2803306_2804680_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AVG35845.1|2804782_2805457_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVG35846.1|2805651_2806272_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	7.1e-63
>prophage 206
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2820007	2822785	4876999		Escherichia_phage(50.0%)	3	NA	NA
AVG35864.1|2820007_2820808_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	9.3e-23
AVG37805.1|2820842_2821739_-	sugar kinase	NA	NA	NA	NA	NA
AVG35865.1|2821894_2822785_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	94.6	1.6e-63
>prophage 207
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2834478	2836952	4876999		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVG35874.1|2834478_2835528_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.3e-08
AVG35875.1|2835539_2836952_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	1.1e-05
>prophage 208
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2840842	2843635	4876999		Enterococcus_phage(100.0%)	1	NA	NA
AVG35880.1|2840842_2843635_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	29.5	1.2e-45
>prophage 209
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2855766	2867842	4876999		Enterobacteria_phage(33.33%)	10	NA	NA
AVG35889.1|2855766_2856759_-	transcriptional regulator RbsR	NA	C6ZCU4	Enterobacteria_phage	34.3	4.8e-37
AVG37807.1|2856762_2857692_-	ribokinase	NA	NA	NA	NA	NA
AVG35890.1|2857798_2858689_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.7	2.0e-05
AVG35891.1|2858716_2859682_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVG35892.1|2859686_2861192_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.7	1.3e-17
AVG35893.1|2861199_2861619_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVG35894.1|2861816_2863685_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.4	3.0e-64
AVG35895.1|2863907_2865404_+	ATPase RavA	NA	A0A0N9NIH9	Sulfolobus_monocaudavirus	33.5	2.6e-18
AVG35896.1|2865397_2866849_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
AVG35897.1|2866849_2867842_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	36.4	1.2e-48
>prophage 210
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2879625	2890239	4876999		Chrysochromulina_ericina_virus(20.0%)	9	NA	NA
AVG35911.1|2879625_2880996_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	33.9	1.5e-33
AVG35912.1|2881234_2883064_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.0	3.3e-132
AVG35913.1|2883385_2884426_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.9	1.2e-49
AVG35914.1|2884554_2885514_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AVG35915.1|2885513_2886404_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AVG35916.1|2886451_2887225_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	2.6e-14
AVG35917.1|2887251_2887977_+	phosphate-specific transport system accessory protein PhoU	NA	NA	NA	NA	NA
AVG35918.1|2888071_2888737_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AVG35919.1|2888898_2890239_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.3	4.3e-65
>prophage 211
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2897112	2904462	4876999		Staphylococcus_phage(33.33%)	8	NA	NA
AVG35926.1|2897112_2897370_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AVG35927.1|2897333_2897693_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVG35928.1|2897709_2897850_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVG35929.1|2897961_2898144_+	hypothetical protein	NA	NA	NA	NA	NA
AVG35930.1|2898449_2899844_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVG35931.1|2899848_2900949_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.6	4.1e-53
AVG35932.1|2900948_2902022_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVG35933.1|2902050_2904462_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	1.4e-114
>prophage 212
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2911212	2912361	4876999		Oenococcus_phage(100.0%)	1	NA	NA
AVG35941.1|2911212_2912361_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 213
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2915700	2916676	4876999		uncultured_virus(50.0%)	2	NA	NA
AVG37808.1|2915700_2916111_+	heat shock protein IbpA	NA	A0A218MKI2	uncultured_virus	39.2	2.4e-19
AVG35945.1|2916247_2916676_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	39.1	1.9e-14
>prophage 214
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2928087	2933359	4876999		Salmonella_phage(50.0%)	6	NA	NA
AVG35956.1|2928087_2929272_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	25.3	8.1e-15
AVG35957.1|2929447_2930281_-	EamA family transporter	NA	NA	NA	NA	NA
AVG35958.1|2930343_2930790_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVG35959.1|2930854_2930944_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVG35960.1|2931465_2931564_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVG35961.1|2931670_2933359_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.3	2.2e-58
>prophage 215
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2953137	2957312	4876999		Escherichia_phage(33.33%)	5	NA	NA
AVG35983.1|2953137_2954226_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	63.0	1.2e-126
AVG35984.1|2954372_2955332_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AVG35985.1|2955434_2955845_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AVG35986.1|2955944_2956670_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	42.2	9.9e-40
AVG35987.1|2956787_2957312_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	57.5	6.4e-49
>prophage 216
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2968553	2973754	4876999	transposase	Leptospira_phage(33.33%)	6	NA	NA
AVG35998.1|2968553_2969674_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG35999.1|2969840_2970182_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
AVG36000.1|2970318_2970510_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AVG36001.1|2970511_2971183_-	TIGR02646 family protein	NA	NA	NA	NA	NA
AVG36002.1|2971179_2972838_-	DUF2813 domain-containing protein	NA	C7BGE8	Burkholderia_phage	34.3	6.4e-10
AVG36003.1|2972821_2973754_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.9	5.9e-21
>prophage 217
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2980163	2981555	4876999		environmental_Halophage(100.0%)	1	NA	NA
AVG36007.1|2980163_2981555_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	3.0e-69
>prophage 218
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2985764	2990774	4876999		Bordetella_phage(33.33%)	4	NA	NA
AVG36011.1|2985764_2987879_-	guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AVG36012.1|2987898_2988174_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVG36013.1|2988228_2988852_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.0e-20
AVG36014.1|2989103_2990774_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.6	1.9e-25
>prophage 219
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	2994771	3002371	4876999		Xanthomonas_phage(20.0%)	10	NA	NA
AVG36020.1|2994771_2995227_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.6e-48
AVG37810.1|2995207_2996419_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.3	1.2e-42
AVG36021.1|2996589_2997258_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVG36022.1|2997476_2997713_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVG36023.1|2997735_2997903_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVG36024.1|2997975_2998785_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.3	5.9e-25
AVG36025.1|2998787_2999267_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.9	4.1e-26
AVG36026.1|2999270_3000041_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVG36027.1|3000040_3001315_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AVG36028.1|3001381_3002371_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	27.3	9.4e-09
>prophage 220
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3012072	3015455	4876999		Prochlorococcus_phage(33.33%)	3	NA	NA
AVG36038.1|3012072_3013005_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	6.5e-36
AVG36039.1|3013220_3014417_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.1	1.6e-34
AVG36040.1|3014426_3015455_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
>prophage 221
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3019562	3023341	4876999		Planktothrix_phage(50.0%)	4	NA	NA
AVG36045.1|3019562_3020846_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.0	2.1e-08
AVG36046.1|3020855_3022400_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVG36047.1|3022646_3023078_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVG36048.1|3023089_3023341_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	6.4e-15
>prophage 222
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3040241	3042080	4876999	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVG36065.1|3040241_3042080_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	25.5	8.1e-14
>prophage 223
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3054410	3055952	4876999		Staphylococcus_phage(100.0%)	1	NA	NA
AVG36076.1|3054410_3055952_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
>prophage 224
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3061793	3062789	4876999		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVG36081.1|3061793_3062789_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	23.8	1.1e-09
>prophage 225
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3066684	3071166	4876999		Streptococcus_phage(33.33%)	5	NA	NA
AVG36085.1|3066684_3068304_+	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	25.4	1.5e-24
AVG36086.1|3068343_3068631_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG36087.1|3068962_3069673_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
AVG36088.1|3069920_3070133_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVG36089.1|3070191_3071166_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	27.3	3.1e-20
>prophage 226
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3076408	3078736	4876999		Escherichia_phage(100.0%)	1	NA	NA
AVG36095.1|3076408_3078736_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	1.7e-72
>prophage 227
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3088430	3108205	4876999		Planktothrix_phage(12.5%)	15	NA	NA
AVG36105.1|3088430_3089414_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	4.3e-14
AVG36106.1|3089410_3090424_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
AVG36107.1|3090468_3091419_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.5e-27
AVG36108.1|3092297_3093482_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	1.5e-13
AVG36109.1|3093707_3094091_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AVG36110.1|3094092_3094638_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
AVG36111.1|3094793_3095222_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
AVG36112.1|3095225_3095930_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
AVG36113.1|3096221_3096719_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
AVG36114.1|3096785_3097151_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AVG36115.1|3097470_3101499_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	3.6e-22
AVG36116.1|3101575_3105799_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.8	8.5e-67
AVG36117.1|3105857_3106175_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AVG36118.1|3106174_3106483_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AVG36119.1|3106663_3108205_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	3.5e-10
>prophage 228
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3116624	3122077	4876999		Klosneuvirus(33.33%)	6	NA	NA
AVG36129.1|3116624_3117293_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.6	2.9e-22
AVG36130.1|3117337_3117928_+	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVG36131.1|3118114_3118387_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
AVG36132.1|3118398_3119091_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
AVG36133.1|3119179_3120472_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AVG36134.1|3120487_3122077_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.4	1.4e-67
>prophage 229
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3134828	3138512	4876999		Dickeya_phage(100.0%)	1	NA	NA
AVG36140.1|3134828_3138512_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	91.8	2.2e-26
>prophage 230
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3156264	3157374	4876999		Mycoplasma_phage(100.0%)	1	NA	NA
AVG36158.1|3156264_3157374_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 231
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3161489	3164364	4876999		Streptococcus_phage(50.0%)	2	NA	NA
AVG36162.1|3161489_3163661_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.3	3.9e-116
AVG36163.1|3163737_3164364_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	63.7	2.9e-32
>prophage 232
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3167375	3171600	4876999		Staphylococcus_phage(33.33%)	4	NA	NA
AVG36168.1|3167375_3168041_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.8e-14
AVG36169.1|3168033_3169089_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVG36170.1|3169340_3170198_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.7	4.1e-45
AVG36171.1|3170334_3171600_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	1.3e-26
>prophage 233
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3177143	3178626	4876999		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVG36177.1|3177143_3177911_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	8.3e-13
AVG36178.1|3177912_3178626_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.2	1.4e-14
>prophage 234
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3182138	3183952	4876999		Planktothrix_phage(50.0%)	2	NA	NA
AVG36182.1|3182138_3183209_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.2	7.5e-20
AVG36183.1|3183205_3183952_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	6.4e-10
>prophage 235
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3195154	3195763	4876999		Lactococcus_phage(100.0%)	1	NA	NA
AVG36193.1|3195154_3195763_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	39.2	4.1e-15
>prophage 236
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3202853	3206949	4876999		Escherichia_phage(25.0%)	4	NA	NA
AVG36201.1|3202853_3204266_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	8.2e-200
AVG36202.1|3204282_3205362_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	4.7e-30
AVG36203.1|3205384_3205942_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	29.7	2.7e-13
AVG36204.1|3205938_3206949_+	ATPase	NA	K4F711	Cronobacter_phage	27.3	2.4e-23
>prophage 237
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3210042	3213646	4876999		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVG36209.1|3210042_3212865_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
AVG36210.1|3213115_3213646_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	97.2	1.5e-53
>prophage 238
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3218351	3219701	4876999		Moraxella_phage(100.0%)	1	NA	NA
AVG36216.1|3218351_3219701_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	8.8e-159
>prophage 239
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3225775	3236314	4876999	transposase	Staphylococcus_phage(25.0%)	7	NA	NA
AVG36223.1|3225775_3227734_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.9	2.3e-91
AVG36224.1|3228157_3229471_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AVG36225.1|3230346_3230499_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AVG36226.1|3230600_3231970_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
AVG36227.1|3232267_3234415_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.5	1.9e-30
AVG36228.1|3234670_3235402_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG36229.1|3235405_3236314_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	38.7	7.5e-37
>prophage 240
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3241111	3242632	4876999		Staphylococcus_phage(100.0%)	1	NA	NA
AVG36235.1|3241111_3242632_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	2.7e-15
>prophage 241
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3248415	3249861	4876999		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AVG36242.1|3248415_3249096_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.6	2.5e-08
AVG36243.1|3249105_3249861_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.2	6.7e-15
>prophage 242
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3255412	3256201	4876999		Pithovirus(100.0%)	1	NA	NA
AVG36251.1|3255412_3256201_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.8	5.5e-12
>prophage 243
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3262742	3264245	4876999		Burkholderia_virus(100.0%)	1	NA	NA
AVG36257.1|3262742_3264245_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	4.5e-55
>prophage 244
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3280491	3282460	4876999		Cronobacter_phage(50.0%)	2	NA	NA
AVG36268.1|3280491_3280785_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
AVG36269.1|3280816_3282460_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.3	1.2e-189
>prophage 245
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3286286	3286817	4876999		Morganella_phage(100.0%)	1	NA	NA
AVG36277.1|3286286_3286817_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.8	2.7e-47
>prophage 246
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3290637	3293716	4876999		Lactobacillus_phage(50.0%)	2	NA	NA
AVG36282.1|3290637_3292428_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.5	1.4e-15
AVG36283.1|3292738_3293716_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.5e-27
>prophage 247
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3299329	3299875	4876999		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVG36287.1|3299329_3299875_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	5.3e-30
>prophage 248
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3303773	3316759	4876999	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
AVG36291.1|3303773_3305114_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.7e-16
AVG36292.1|3305123_3306968_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.2	9.8e-60
AVG36293.1|3306960_3307911_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVG36294.1|3307996_3308308_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AVG36295.1|3308382_3309663_+	GTPase HflX	NA	NA	NA	NA	NA
AVG36296.1|3309719_3310979_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	6.2e-05
AVG36297.1|3310981_3311986_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AVG36298.1|3312057_3312255_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AVG37816.1|3312359_3313658_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	4.9e-66
AVG36299.1|3313850_3314276_+	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AVG36300.1|3314314_3316759_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	8.4e-67
>prophage 249
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3320724	3322656	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG36304.1|3320724_3322656_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	2.0e-15
>prophage 250
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3330957	3332607	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG36315.1|3330957_3332607_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	7.0e-09
>prophage 251
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3353186	3361709	4876999		uncultured_Caudovirales_phage(50.0%)	8	NA	NA
AVG36333.1|3353186_3353717_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
AVG36334.1|3354026_3354983_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG36335.1|3355040_3356543_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	2.0e-10
AVG36336.1|3356556_3357579_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG36337.1|3357565_3358567_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AVG36338.1|3358660_3360232_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.3	7.9e-10
AVG36339.1|3360203_3360560_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG36340.1|3360710_3361709_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	5.7e-70
>prophage 252
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3374869	3378140	4876999		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AVG36355.1|3374869_3375112_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	52.5	5.6e-16
AVG36356.1|3375101_3375386_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	67.0	1.8e-29
AVG36357.1|3375389_3375854_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2D0YLR2	Vibrio_phage	57.1	1.2e-51
AVG36358.1|3376001_3378140_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.7	3.1e-267
>prophage 253
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3381758	3385804	4876999		Enterobacteria_phage(50.0%)	2	NA	NA
AVG36360.1|3381758_3382706_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	22.7	1.2e-13
AVG36361.1|3383095_3385804_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	28.4	1.3e-36
>prophage 254
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3389383	3390316	4876999		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVG36365.1|3389383_3390316_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	1.7e-52
>prophage 255
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3407024	3449336	4876999	plate,lysis,transposase,tRNA,integrase,tail	Erwinia_phage(37.5%)	51	3408704:3408728	3427896:3427920
AVG36381.1|3407024_3407783_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
AVG36382.1|3407813_3408536_+	topoisomerase II	NA	NA	NA	NA	NA
3408704:3408728	attL	GTTCGAGTCCGGCCTTCGGCACCAT	NA	NA	NA	NA
AVG36383.1|3408916_3410167_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	39.8	1.0e-84
AVG36384.1|3410278_3411088_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36385.1|3411254_3411461_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	41.5	5.9e-06
AVG36386.1|3411481_3411781_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36387.1|3412076_3413279_+|integrase	integrase	integrase	NA	NA	NA	NA
AVG36388.1|3413271_3414576_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AVG36389.1|3414572_3416447_+	DNA-binding protein	NA	NA	NA	NA	NA
AVG36390.1|3416461_3416848_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36391.1|3416943_3417372_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36392.1|3417462_3418164_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AVG36393.1|3418238_3418469_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36394.1|3418523_3418841_-	cell wall-binding protein	NA	NA	NA	NA	NA
AVG36395.1|3418860_3419247_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36396.1|3419276_3419555_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36397.1|3419777_3420923_-	relaxase	NA	NA	NA	NA	NA
AVG36398.1|3420891_3421305_-	hypothetical protein	NA	NA	NA	NA	NA
AVG37823.1|3421505_3422024_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36399.1|3422033_3422927_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
AVG36400.1|3423079_3423325_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36401.1|3423313_3423769_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36402.1|3424963_3426103_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVG36403.1|3426099_3427584_-	hypothetical protein	NA	Q684B3	Sulfolobus_virus	22.0	1.4e-08
AVG36404.1|3428875_3429160_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
3427896:3427920	attR	GTTCGAGTCCGGCCTTCGGCACCAT	NA	NA	NA	NA
AVG36405.1|3429156_3430011_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	8.0e-81
AVG36406.1|3430656_3431776_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG36407.1|3432697_3433273_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.3	4.4e-67
AVG36408.1|3433500_3433839_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	71.2	1.5e-38
AVG36409.1|3433907_3434135_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	61.3	3.8e-14
AVG36410.1|3434134_3434356_+	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	76.4	1.2e-25
AVG36411.1|3434357_3436547_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	72.9	0.0e+00
AVG36412.1|3436656_3437097_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	75.9	1.6e-53
AVG36413.1|3437276_3437480_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	71.6	4.0e-23
AVG36414.1|3437470_3437692_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	73.6	1.1e-23
AVG36415.1|3437675_3438185_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	81.5	9.6e-74
AVG36416.1|3438181_3438607_+	protein lysB	NA	A0A218M4K2	Erwinia_phage	56.7	2.1e-29
AVG36417.1|3438566_3438740_+|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	74.5	8.1e-17
AVG36418.1|3438702_3439170_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	61.3	1.4e-50
AVG36419.1|3439282_3439924_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	76.5	1.7e-88
AVG36420.1|3439920_3440271_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	3.1e-39
AVG36421.1|3440276_3441221_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	86.1	1.6e-119
AVG36422.1|3441204_3441477_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37824.1|3441920_3442151_+	hypothetical protein	NA	I6S1K6	Salmonella_phage	59.2	8.8e-19
AVG36423.1|3442403_3442619_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36424.1|3442970_3443477_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AVG36425.1|3444008_3445856_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AVG36426.1|3445872_3445992_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVG36427.1|3446009_3447755_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	2.4e-76
AVG36428.1|3447870_3448086_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVG36429.1|3448322_3449336_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	2.8e-109
>prophage 256
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3455017	3456031	4876999		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
AVG36438.1|3455017_3456031_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	38.8	4.7e-56
>prophage 257
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3460227	3461469	4876999		Sinorhizobium_phage(100.0%)	1	NA	NA
AVG36444.1|3460227_3461469_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.4	1.0e-92
>prophage 258
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3466598	3482890	4876999		uncultured_Mediterranean_phage(14.29%)	15	NA	NA
AVG36448.1|3466598_3468029_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	2.5e-39
AVG36449.1|3468143_3468476_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36450.1|3468816_3469470_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.4	7.8e-44
AVG36451.1|3469502_3470276_-	zinc transporter ZupT	NA	NA	NA	NA	NA
AVG36452.1|3470472_3471261_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AVG36453.1|3471353_3472514_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	7.7e-87
AVG36454.1|3472516_3473185_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	47.5	1.5e-39
AVG36455.1|3473374_3474853_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
AVG36456.1|3475057_3475690_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.6	5.8e-20
AVG36457.1|3475686_3476109_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36458.1|3476136_3476964_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AVG36459.1|3476963_3477545_+	esterase YqiA	NA	NA	NA	NA	NA
AVG36460.1|3477573_3479466_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.2	3.8e-91
AVG36461.1|3479549_3481691_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVG36462.1|3482077_3482890_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	9.4e-15
>prophage 259
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3490527	3493306	4876999		Stx_converting_phage(50.0%)	2	NA	NA
AVG37825.1|3490527_3490929_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	43.6	4.8e-20
AVG36472.1|3491047_3493306_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.3	1.7e-85
>prophage 260
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3499943	3526752	4876999	transposase,integrase	Staphylococcus_phage(22.22%)	22	3497313:3497327	3502936:3502950
3497313:3497327	attL	TTTTCTTCAAATCTG	NA	NA	NA	NA
AVG36478.1|3499943_3501191_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AVG36479.1|3501177_3502944_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36480.1|3502931_3505049_+	hypothetical protein	NA	NA	NA	NA	NA
3502936:3502950	attR	CAGATTTGAAGAAAA	NA	NA	NA	NA
AVG36481.1|3505052_3505481_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36482.1|3505829_3506981_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.7e-41
AVG37826.1|3508029_3508338_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG36483.1|3508433_3509558_-	alkene reductase	NA	NA	NA	NA	NA
AVG36484.1|3509775_3510228_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG36485.1|3510193_3510754_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36486.1|3510778_3511844_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG37827.1|3512529_3513453_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AVG36487.1|3515616_3515967_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
AVG36488.1|3515963_3516266_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	39.0	3.2e-08
AVG36489.1|3516365_3516716_+	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	6.9e-39
AVG36490.1|3516635_3517787_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.7e-41
AVG36491.1|3518729_3519806_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVG36492.1|3520393_3521230_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AVG36493.1|3521294_3521693_-	VOC family protein	NA	NA	NA	NA	NA
AVG36494.1|3521736_3522846_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.7	2.2e-30
AVG36495.1|3522880_3523156_-	regulator protein FrmR	NA	NA	NA	NA	NA
AVG36496.1|3524503_3524800_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVG36497.1|3525828_3526752_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
>prophage 261
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3530633	3532567	4876999		Pseudomonas_phage(50.0%)	2	NA	NA
AVG36500.1|3530633_3531656_+	DUF3362 domain-containing protein	NA	M1QSD9	Pseudomonas_phage	71.2	5.5e-105
AVG36501.1|3531739_3532567_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.6	2.9e-64
>prophage 262
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3541788	3543336	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG36513.1|3541788_3543336_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.5	2.9e-12
>prophage 263
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3549532	3553460	4876999		Planktothrix_phage(50.0%)	3	NA	NA
AVG36521.1|3549532_3550510_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	1.3e-15
AVG36522.1|3550506_3551484_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AVG36523.1|3551594_3553460_+	bifunctional glutathionylspermidine amidase/synthase	NA	A0A219Y9C1	Aeromonas_phage	23.7	7.7e-20
>prophage 264
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3591877	3593032	4876999		Staphylococcus_phage(100.0%)	1	NA	NA
AVG36562.1|3591877_3593032_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.1e-128
>prophage 265
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3609967	3611200	4876999		Catovirus(100.0%)	1	NA	NA
AVG36576.1|3609967_3611200_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	3.7e-103
>prophage 266
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3618996	3624179	4876999		Prochlorococcus_phage(50.0%)	3	NA	NA
AVG36584.1|3618996_3621870_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.2	1.0e-260
AVG36585.1|3621940_3622684_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVG36586.1|3622745_3624179_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.4	1.8e-29
>prophage 267
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3628850	3645639	4876999	transposase,integrase,tRNA	Brevibacillus_phage(10.0%)	15	3619934:3619947	3649137:3649150
3619934:3619947	attL	CGCTGCGCATGGCG	NA	NA	NA	NA
AVG36594.1|3628850_3629747_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.8	6.7e-30
AVG36595.1|3629775_3630489_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVG36596.1|3630494_3632228_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	5.8e-62
AVG36597.1|3632318_3633416_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AVG36598.1|3633426_3634944_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	7.7e-87
AVG36599.1|3634982_3635525_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVG37831.1|3635742_3636432_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A7K9	Microcystis_virus	34.9	7.7e-10
AVG36600.1|3636675_3638616_+|integrase	integrase	integrase	A0A059XK29	uncultured_phage	28.7	1.4e-11
AVG36601.1|3638857_3639409_-	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	36.1	7.8e-21
AVG36602.1|3639511_3640042_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36603.1|3640109_3641230_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG36604.1|3641364_3641724_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36605.1|3641784_3642054_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36606.1|3642964_3644116_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.7e-41
AVG36607.1|3644568_3645639_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	3.0e-29
3649137:3649150	attR	CGCTGCGCATGGCG	NA	NA	NA	NA
>prophage 268
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3658325	3660821	4876999		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVG36621.1|3658325_3659087_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	5.9e-19
AVG36622.1|3659399_3660821_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.0	7.1e-26
>prophage 269
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3665204	3670708	4876999		Enterobacteria_phage(50.0%)	4	NA	NA
AVG36627.1|3665204_3666242_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.1	4.5e-30
AVG37832.1|3666471_3666948_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVG36628.1|3666908_3667925_-	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
AVG36629.1|3668548_3670708_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	9.8e-19
>prophage 270
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3675425	3679542	4876999		Hokovirus(50.0%)	3	NA	NA
AVG36635.1|3675425_3677672_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	24.7	1.7e-10
AVG36636.1|3677865_3678741_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVG36637.1|3678747_3679542_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	1.7e-117
>prophage 271
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3684975	3700303	4876999	tRNA	Klosneuvirus(16.67%)	10	NA	NA
AVG36642.1|3684975_3687843_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.5	4.3e-62
AVG36643.1|3687839_3691382_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.3	1.9e-11
AVG36644.1|3691378_3693199_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.9	9.1e-26
AVG36645.1|3693253_3694585_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AVG36646.1|3694812_3696066_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.0	8.0e-13
AVG37834.1|3696508_3696682_+	murein transglycosylase	NA	NA	NA	NA	NA
AVG36647.1|3696681_3697779_+	murein transglycosylase A	NA	NA	NA	NA	NA
AVG36648.1|3697854_3698661_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.7	1.1e-15
AVG36649.1|3698651_3699098_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVG36650.1|3699097_3700303_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.4e-70
>prophage 272
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3703625	3704381	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG36655.1|3703625_3704381_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.1	7.2e-09
>prophage 273
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3709219	3710062	4876999		Vibrio_phage(100.0%)	1	NA	NA
AVG36659.1|3709219_3710062_-	preQ(1) synthase	NA	A0A2I7SAX1	Vibrio_phage	36.3	1.4e-40
>prophage 274
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3714534	3722656	4876999		Oenococcus_phage(25.0%)	5	NA	NA
AVG37835.1|3714534_3715875_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	23.0	2.7e-06
AVG36665.1|3715890_3717228_+	glucarate dehydratase	NA	NA	NA	NA	NA
AVG36666.1|3717305_3718445_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.6	8.2e-49
AVG36667.1|3718540_3721300_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.2	9.2e-54
AVG36668.1|3721357_3722656_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.5	3.3e-38
>prophage 275
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3726021	3729040	4876999		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
AVG36671.1|3726021_3727659_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.5	2.7e-154
AVG36672.1|3727741_3729040_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.2	8.3e-130
>prophage 276
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3733872	3734544	4876999		Vibrio_phage(100.0%)	1	NA	NA
AVG36677.1|3733872_3734544_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	31.4	1.4e-11
>prophage 277
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3743265	3745295	4876999		Hokovirus(50.0%)	2	NA	NA
AVG36685.1|3743265_3744690_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.0	2.2e-35
AVG36686.1|3744689_3745295_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	1.9e-28
>prophage 278
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3748393	3752068	4876999		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVG36692.1|3748393_3749155_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.8	1.7e-58
AVG36693.1|3749148_3749775_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	8.2e-35
AVG36694.1|3749891_3751016_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	3.8e-06
AVG36695.1|3751075_3752068_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 279
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3757660	3763090	4876999		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
AVG36702.1|3757660_3760222_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	2.9e-33
AVG36703.1|3760335_3760566_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
AVG36704.1|3760741_3761086_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
AVG36705.1|3761091_3762312_-	MFS transporter	NA	NA	NA	NA	NA
AVG36706.1|3762328_3763090_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	5.5e-17
>prophage 280
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3782184	3783198	4876999		Enterobacteria_phage(100.0%)	1	NA	NA
AVG36726.1|3782184_3783198_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	1.7e-26
>prophage 281
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3791847	3792813	4876999		Tetraselmis_virus(100.0%)	1	NA	NA
AVG36733.1|3791847_3792813_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.5	7.5e-35
>prophage 282
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3798381	3806314	4876999	tRNA	Bodo_saltans_virus(20.0%)	8	NA	NA
AVG36741.1|3798381_3799035_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	24.6	6.9e-08
AVG36742.1|3799031_3799892_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AVG36743.1|3799906_3800785_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG36744.1|3800914_3801412_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.1	7.0e-29
AVG36745.1|3801501_3802560_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	2.0e-113
AVG36746.1|3802627_3803128_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVG36747.1|3803259_3805887_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	8.4e-81
AVG36748.1|3806128_3806314_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 283
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3820455	3825731	4876999		Bacillus_virus(20.0%)	5	NA	NA
AVG36761.1|3820455_3821667_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	1.9e-27
AVG36762.1|3821998_3822958_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.7	5.2e-137
AVG36763.1|3822967_3825112_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.9	1.5e-200
AVG36764.1|3825084_3825495_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	45.1	4.6e-18
AVG36765.1|3825491_3825731_-	NrdH-redoxin	NA	A0A0M7REK7	Lactobacillus_phage	43.2	2.9e-12
>prophage 284
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3830901	3831507	4876999		Canarypox_virus(100.0%)	1	NA	NA
AVG36775.1|3830901_3831507_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.1	1.8e-07
>prophage 285
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3845217	3847416	4876999		Bacillus_phage(100.0%)	1	NA	NA
AVG36786.1|3845217_3847416_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.9	1.3e-31
>prophage 286
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3866566	3965246	4876999	plate,capsid,portal,head,terminase,holin,transposase,tRNA,integrase,tail	Escherichia_phage(21.82%)	105	3896478:3896495	3927696:3927713
AVG37840.1|3866566_3867490_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AVG36797.1|3868100_3868703_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36798.1|3869772_3869934_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVG36799.1|3869940_3871059_+	radical SAM protein	NA	NA	NA	NA	NA
AVG36800.1|3871073_3871664_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36801.1|3871788_3872433_+	radical SAM protein	NA	NA	NA	NA	NA
AVG36802.1|3872879_3873999_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG37841.1|3874757_3875681_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AVG37842.1|3875747_3876071_-	recombinase	NA	Q9XJF6	Enterococcus_phage	33.7	2.7e-05
AVG37843.1|3876407_3877637_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	89.7	6.0e-215
AVG36803.1|3878255_3878738_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AVG36804.1|3878855_3879332_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AVG36805.1|3879321_3879609_+	RnfH family protein	NA	NA	NA	NA	NA
AVG36806.1|3879712_3880051_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVG36807.1|3880189_3881851_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AVG36808.1|3881936_3882815_-	NAD(+) kinase	NA	NA	NA	NA	NA
AVG36809.1|3882913_3883531_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVG36810.1|3883583_3884870_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVG37844.1|3884889_3885681_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVG36811.1|3885847_3887209_+	signal recognition particle protein	NA	NA	NA	NA	NA
AVG36812.1|3887325_3887574_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVG36813.1|3887589_3888129_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVG36814.1|3888160_3888928_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVG36815.1|3888971_3889319_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVG36816.1|3889450_3889855_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AVG36817.1|3889894_3891265_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AVG36818.1|3891267_3891753_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36819.1|3891765_3892986_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.6	7.0e-06
AVG36820.1|3892978_3893575_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVG36821.1|3893667_3894042_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AVG36822.1|3894257_3895328_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	9.0e-90
AVG36823.1|3895338_3896460_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
3896478:3896495	attL	TGAAAGCCAGCATTGCTG	NA	NA	NA	NA
AVG36824.1|3896602_3896824_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.9	2.7e-25
AVG36825.1|3896900_3898070_-	hypothetical protein	NA	Q6K1G4	Salmonella_virus	75.4	4.3e-162
AVG36826.1|3898066_3898531_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	1.2e-59
AVG36827.1|3898543_3900991_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	52.6	2.1e-203
AVG36828.1|3900980_3901103_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.0e-13
AVG36829.1|3901135_3901444_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	73.6	2.4e-27
AVG36830.1|3901504_3902023_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.0	1.0e-78
AVG36831.1|3902035_3903229_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	80.4	1.4e-184
AVG36832.1|3903378_3903987_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	43.3	1.2e-27
AVG36833.1|3903986_3906137_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	79.9	4.8e-90
AVG36834.1|3906144_3906678_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.3	1.2e-90
AVG36835.1|3906670_3907579_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	82.5	1.9e-136
AVG36836.1|3907584_3907935_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	69.8	2.0e-38
AVG36837.1|3907931_3908573_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.1	5.4e-98
AVG36838.1|3908641_3909091_-	phage virion morphogenesis protein	NA	Q6K1H7	Salmonella_virus	67.3	1.4e-49
AVG36839.1|3909083_3909551_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.3	1.7e-61
AVG36840.1|3909513_3909759_-|holin	holin	holin	S4TNY4	Salmonella_phage	79.0	1.5e-29
AVG36841.1|3909646_3910072_-	protein lysB	NA	O80310	Escherichia_phage	70.1	2.0e-45
AVG36842.1|3910068_3910578_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	85.7	2.4e-77
AVG36843.1|3910561_3910783_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	75.3	1.4e-26
AVG36844.1|3910773_3910977_-|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	79.1	1.5e-25
AVG36845.1|3910976_3911483_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.2	3.2e-61
AVG36846.1|3911582_3912338_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	66.9	3.6e-77
AVG36847.1|3912341_3913409_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.1	3.9e-170
AVG36848.1|3913464_3914319_-|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	72.9	4.5e-116
AVG36849.1|3914485_3916255_+	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	85.4	1.2e-301
AVG36850.1|3916256_3917282_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.2	1.6e-168
AVG36851.1|3917734_3918838_+	chromosome partitioning protein ParB	NA	Q858T2	Yersinia_virus	60.1	7.1e-98
AVG36852.1|3918824_3919817_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36853.1|3919813_3920758_-	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	86.9	1.8e-163
AVG36854.1|3921022_3923308_-	replication endonuclease	NA	Q858T4	Yersinia_virus	75.4	0.0e+00
AVG36855.1|3923297_3923573_-	hypothetical protein	NA	M1TAP2	Escherichia_phage	61.5	2.0e-25
AVG36856.1|3923589_3923805_-	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AVG36857.1|3923869_3924370_-	replication protein B	NA	M1SV55	Escherichia_phage	88.0	8.5e-83
AVG36858.1|3924360_3924540_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	64.9	1.4e-11
AVG36859.1|3924542_3924815_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	80.0	3.4e-38
AVG36860.1|3924973_3925270_+	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	81.2	9.6e-34
AVG36861.1|3925290_3925575_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVG36862.1|3925571_3926426_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	8.0e-81
AVG36863.1|3926569_3927550_+|integrase	integrase	integrase	Q7Y4C5	Escherichia_virus	79.8	4.9e-151
AVG36864.1|3927738_3928611_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
3927696:3927713	attR	TGAAAGCCAGCATTGCTG	NA	NA	NA	NA
AVG36865.1|3928607_3929768_-	prephenate dehydratase	NA	NA	NA	NA	NA
AVG37845.1|3929875_3929923_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36866.1|3930034_3930376_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AVG36867.1|3930644_3931382_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVG36868.1|3931513_3932494_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AVG36869.1|3932490_3933222_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AVG36870.1|3933351_3935925_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	9.0e-128
AVG36871.1|3941550_3942846_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.0	4.5e-43
AVG36872.1|3942842_3943166_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36873.1|3943211_3944567_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AVG36874.1|3944677_3947341_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AVG36875.1|3947376_3948075_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AVG36876.1|3948144_3948564_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.5	3.1e-14
AVG36877.1|3948768_3949899_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVG36878.1|3949947_3950637_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	6.0e-55
AVG36879.1|3950951_3951335_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	1.6e-33
AVG36880.1|3951386_3952715_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	1.8e-47
AVG36881.1|3952847_3953585_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AVG36882.1|3953569_3955189_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AVG36883.1|3955613_3956189_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
AVG36884.1|3956220_3956871_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AVG36885.1|3956870_3957824_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AVG36886.1|3957820_3958297_+	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AVG36887.1|3958482_3960282_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
AVG36888.1|3960297_3961272_+	signal peptidase I	NA	NA	NA	NA	NA
AVG36889.1|3961299_3961551_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36890.1|3961494_3962175_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
AVG36891.1|3962171_3963077_+	GTPase Era	NA	NA	NA	NA	NA
AVG36892.1|3963094_3963802_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AVG36893.1|3963877_3964609_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVG36894.1|3964608_3964989_+	holo-ACP synthase	NA	NA	NA	NA	NA
AVG36895.1|3964985_3965246_-	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	50.0	2.5e-17
>prophage 287
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3971432	3982577	4876999		Bacillus_phage(50.0%)	7	NA	NA
AVG36903.1|3971432_3975320_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	2.2e-130
AVG36904.1|3975854_3977282_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	1.1e-13
AVG36905.1|3977283_3978021_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVG36906.1|3978007_3979345_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.0	1.2e-09
AVG36907.1|3979410_3979749_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AVG36908.1|3979828_3981019_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AVG36909.1|3981323_3982577_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
>prophage 288
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	3990509	3996818	4876999		Faustovirus(20.0%)	8	NA	NA
AVG36919.1|3990509_3991724_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
AVG36920.1|3991748_3992135_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	1.2e-52
AVG36921.1|3992148_3992472_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	4.5e-21
AVG36922.1|3992551_3993067_+	co-chaperone HscB	NA	NA	NA	NA	NA
AVG36923.1|3993081_3994932_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	2.4e-106
AVG36924.1|3994933_3995269_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVG36925.1|3995270_3995471_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVG36926.1|3995531_3996818_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.0	4.5e-35
>prophage 289
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4010041	4010473	4876999		Powai_lake_megavirus(100.0%)	1	NA	NA
AVG36934.1|4010041_4010473_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	7.4e-19
>prophage 290
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4019327	4025573	4876999		Acinetobacter_phage(33.33%)	6	NA	NA
AVG36941.1|4019327_4020869_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	4.1e-160
AVG36942.1|4020927_4021149_+	hypothetical protein	NA	NA	NA	NA	NA
AVG36943.1|4021145_4021496_-	hypothetical protein	NA	NA	NA	NA	NA
AVG36944.1|4021496_4022516_-	peptidase M4 family protein	NA	NA	NA	NA	NA
AVG36945.1|4022574_4023948_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.4e-41
AVG36946.1|4024106_4025573_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	3.0e-88
>prophage 291
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4029913	4035689	4876999		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
AVG36950.1|4029913_4031839_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.2	1.6e-28
AVG36951.1|4032139_4033126_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
AVG36952.1|4033157_4034087_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG36953.1|4034141_4035689_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	4.6e-10
>prophage 292
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4046760	4046949	4876999		Escherichia_phage(100.0%)	1	NA	NA
AVG36965.1|4046760_4046949_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	71.2	6.1e-18
>prophage 293
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4053356	4061190	4876999		Prochlorococcus_phage(50.0%)	7	NA	NA
AVG36969.1|4053356_4053998_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.6	9.0e-29
AVG36970.1|4053994_4055032_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.1	3.7e-72
AVG36971.1|4055298_4056729_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVG36972.1|4056886_4057513_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVG36973.1|4057596_4058886_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	5.4e-65
AVG36974.1|4058967_4059684_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AVG36975.1|4059732_4061190_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	32.9	3.6e-41
>prophage 294
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4070880	4071594	4876999		Cyanophage(100.0%)	1	NA	NA
AVG36986.1|4070880_4071594_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.5e-37
>prophage 295
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4093059	4112849	4876999		Streptococcus_phage(25.0%)	23	NA	NA
AVG37002.1|4093059_4093935_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	1.1e-16
AVG37003.1|4094147_4094573_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVG37004.1|4094559_4095009_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AVG37005.1|4095072_4095648_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVG37006.1|4095740_4096640_+	peroxidase	NA	S4VVJ7	Pandoravirus	33.8	7.2e-24
AVG37007.1|4096812_4097826_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG37008.1|4097825_4098659_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AVG37009.1|4098658_4099534_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AVG37010.1|4099523_4100618_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	33.2	5.5e-26
AVG37011.1|4100736_4101648_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.4	9.4e-56
AVG37012.1|4101653_4102490_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
AVG37013.1|4102534_4103044_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AVG37014.1|4103084_4104812_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	4.3e-17
AVG37015.1|4104856_4105114_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVG37849.1|4105185_4105371_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37016.1|4105301_4105424_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG37017.1|4105431_4106403_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	8.8e-76
AVG37018.1|4106566_4107328_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVG37019.1|4107558_4108530_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVG37020.1|4108599_4110615_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	7.0e-152
AVG37021.1|4110616_4110832_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37022.1|4110828_4111824_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AVG37023.1|4111913_4112849_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.7	2.4e-06
>prophage 296
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4127651	4128377	4876999		Clostridioides_phage(100.0%)	1	NA	NA
AVG37036.1|4127651_4128377_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.6	4.2e-14
>prophage 297
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4132192	4133113	4876999		Morganella_phage(100.0%)	1	NA	NA
AVG37851.1|4132192_4133113_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	52.9	1.2e-74
>prophage 298
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4137832	4138762	4876999		Enterobacteria_phage(100.0%)	1	NA	NA
AVG37044.1|4137832_4138762_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	85.8	8.8e-142
>prophage 299
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4147978	4149064	4876999		Pandoravirus(100.0%)	1	NA	NA
AVG37053.1|4147978_4149064_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	3.2e-87
>prophage 300
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4157513	4158650	4876999		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVG37062.1|4157513_4158650_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.3	1.8e-19
>prophage 301
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4165005	4166523	4876999		Mollivirus(100.0%)	1	NA	NA
AVG37070.1|4165005_4166523_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	4.1e-88
>prophage 302
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4170761	4171535	4876999		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVG37076.1|4170761_4171535_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.8e-08
>prophage 303
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4176248	4177268	4876999		Enterobacteria_phage(100.0%)	1	NA	NA
AVG37083.1|4176248_4177268_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.1	4.2e-20
>prophage 304
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4189020	4189620	4876999		Salmonella_phage(100.0%)	1	NA	NA
AVG37095.1|4189020_4189620_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	1.5e-06
>prophage 305
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4208469	4209474	4876999		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVG37111.1|4208469_4209474_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.8	9.8e-30
>prophage 306
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4226068	4237844	4876999		Pseudomonas_phage(33.33%)	7	NA	NA
AVG37127.1|4226068_4227127_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	7.7e-09
AVG37128.1|4227232_4227487_-	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	66.7	1.1e-27
AVG37853.1|4227486_4228617_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	2.1e-177
AVG37129.1|4228717_4231003_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.3	1.4e-286
AVG37130.1|4231350_4232079_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AVG37131.1|4232225_4234862_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.6	8.1e-92
AVG37132.1|4234997_4237844_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.8	1.2e-43
>prophage 307
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4241957	4251703	4876999	transposase	Escherichia_phage(16.67%)	8	NA	NA
AVG37854.1|4241957_4242881_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AVG37135.1|4243083_4244196_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.6e-119
AVG37136.1|4244310_4245366_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AVG37137.1|4245438_4246497_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	51.1	2.6e-17
AVG37138.1|4246496_4247153_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.7	2.9e-06
AVG37855.1|4247222_4248866_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	21.7	4.1e-09
AVG37139.1|4249014_4250451_+	magnesium transporter	NA	NA	NA	NA	NA
AVG37140.1|4250413_4251703_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.4	6.6e-79
>prophage 308
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4258301	4265819	4876999		Vibrio_phage(50.0%)	7	NA	NA
AVG37147.1|4258301_4259309_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.9	7.7e-83
AVG37148.1|4259359_4259644_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVG37149.1|4259769_4261530_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.4	4.9e-101
AVG37150.1|4261682_4262390_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AVG37151.1|4262405_4263602_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	22.6	1.3e-20
AVG37152.1|4263881_4264226_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37153.1|4264229_4265819_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.4e-17
>prophage 309
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4271513	4275823	4876999		Clostridioides_phage(50.0%)	4	NA	NA
AVG37158.1|4271513_4272083_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	3.6e-13
AVG37159.1|4272510_4273224_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AVG37160.1|4273245_4274232_-	GTP-binding protein	NA	NA	NA	NA	NA
AVG37161.1|4274356_4275823_-	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	29.7	9.9e-39
>prophage 310
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4283713	4284571	4876999		Catovirus(100.0%)	1	NA	NA
AVG37169.1|4283713_4284571_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.7	8.1e-25
>prophage 311
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4288521	4293489	4876999		Acinetobacter_phage(50.0%)	4	NA	NA
AVG37173.1|4288521_4290492_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.9	2.8e-12
AVG37174.1|4290603_4291431_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AVG37175.1|4291569_4292718_+	MFS transporter	NA	NA	NA	NA	NA
AVG37176.1|4292820_4293489_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	5.3e-56
>prophage 312
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4297217	4298738	4876999		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVG37180.1|4297217_4298738_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 313
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4316565	4317120	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG37196.1|4316565_4317120_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	35.9	7.3e-19
>prophage 314
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4323693	4331535	4876999	tRNA	Enterobacteria_phage(60.0%)	8	NA	NA
AVG37201.1|4323693_4324644_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-24
AVG37202.1|4324627_4325365_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG37203.1|4325339_4325453_-	hypothetical protein	NA	NA	NA	NA	NA
AVG37204.1|4325522_4326263_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	81.4	3.9e-92
AVG37205.1|4326480_4328166_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	87.0	1.6e-266
AVG37206.1|4328159_4328879_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AVG37207.1|4328925_4329396_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	74.4	1.0e-61
AVG37208.1|4329501_4331535_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.0	3.0e-54
>prophage 315
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4340036	4342662	4876999		Klosneuvirus(50.0%)	3	NA	NA
AVG37216.1|4340036_4341413_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.1	8.2e-27
AVG37217.1|4341726_4342161_-	hypothetical protein	NA	NA	NA	NA	NA
AVG37858.1|4342371_4342662_-	hypothetical protein	NA	S4TRP0	Salmonella_phage	36.0	2.6e-07
>prophage 316
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4352636	4356743	4876999		Bacillus_phage(66.67%)	4	NA	NA
AVG37227.1|4352636_4353998_-	U32 family peptidase	NA	Q6DW11	Phage_TP	91.8	1.9e-201
AVG37228.1|4354152_4354485_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVG37229.1|4354620_4355343_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.4	2.4e-30
AVG37230.1|4355339_4356743_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.7	6.6e-32
>prophage 317
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4371763	4381091	4876999		Catovirus(25.0%)	7	NA	NA
AVG37238.1|4371763_4372405_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.8	4.5e-36
AVG37239.1|4372496_4373078_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	5.5e-33
AVG37240.1|4373100_4374951_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVG37241.1|4375060_4376644_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-38
AVG37242.1|4377336_4378476_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AVG37243.1|4378482_4378926_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
AVG37244.1|4378928_4381091_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	29.8	1.1e-17
>prophage 318
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4386335	4393049	4876999		Synechococcus_phage(25.0%)	6	NA	NA
AVG37251.1|4386335_4387457_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.7	2.6e-132
AVG37252.1|4387459_4388425_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.6	3.2e-86
AVG37253.1|4388427_4388907_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AVG37254.1|4388903_4390127_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AVG37255.1|4390130_4391567_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.2	1.8e-53
AVG37256.1|4391678_4393049_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	9.9e-33
>prophage 319
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4398497	4411887	4876999		Enterobacteria_phage(33.33%)	13	NA	NA
AVG37261.1|4398497_4399889_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	7.0e-18
AVG37262.1|4400065_4400962_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.8e-43
AVG37263.1|4401346_4402291_+	NAD-dependent epimerase	NA	K7QJG5	Escherichia_phage	23.4	4.5e-08
AVG37264.1|4402290_4403334_+	glycosyl transferase	NA	NA	NA	NA	NA
AVG37265.1|4403326_4403887_+	sugar O-acyltransferase	NA	NA	NA	NA	NA
AVG37266.1|4403925_4405812_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	28.2	3.0e-24
AVG37267.1|4405914_4407000_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	4.8e-99
AVG37268.1|4406999_4407899_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.4	4.8e-28
AVG37269.1|4407950_4408832_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	3.5e-108
AVG37270.1|4408962_4409769_+	amylovoran biosynthesis protein AmsE	NA	NA	NA	NA	NA
AVG37859.1|4409806_4410358_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.4	1.8e-46
AVG37271.1|4410357_4410768_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AVG37272.1|4410777_4411887_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	29.9	3.6e-41
>prophage 320
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4416316	4422619	4876999		Paramecium_bursaria_Chlorella_virus(20.0%)	6	NA	NA
AVG37277.1|4416316_4416775_+	N-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	45.0	1.5e-06
AVG37278.1|4416939_4418346_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.0	8.9e-37
AVG37279.1|4418571_4419738_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	8.2e-113
AVG37280.1|4419789_4420794_-	NAD-dependent epimerase	NA	Q58M85	Prochlorococcus_phage	28.1	4.6e-27
AVG37281.1|4420986_4421967_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
AVG37282.1|4422007_4422619_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	28.3	2.3e-13
>prophage 321
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4428129	4429029	4876999		Cellulophaga_phage(100.0%)	1	NA	NA
AVG37288.1|4428129_4429029_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 322
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4434578	4435745	4876999		Stx2-converting_phage(100.0%)	1	NA	NA
AVG37293.1|4434578_4435745_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.0	1.9e-197
>prophage 323
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4440432	4442199	4876999		Acinetobacter_phage(100.0%)	1	NA	NA
AVG37299.1|4440432_4442199_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.5	1.6e-80
>prophage 324
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4446849	4454566	4876999		Leptospira_phage(33.33%)	4	NA	NA
AVG37304.1|4446849_4449912_-	AcrB/AcrD/AcrF family protein	NA	S5VL66	Leptospira_phage	21.2	5.5e-23
AVG37305.1|4449911_4450907_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVG37306.1|4451393_4451825_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	2.9e-23
AVG37307.1|4451872_4454566_+	carbonate dehydratase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.6	5.2e-70
>prophage 325
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4472904	4477499	4876999		Indivirus(50.0%)	4	NA	NA
AVG37324.1|4472904_4474434_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	27.1	7.1e-48
AVG37325.1|4474526_4475426_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG37326.1|4475400_4476189_-	molybdenum ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG37327.1|4476185_4477499_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.8	4.0e-63
>prophage 326
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4481597	4484378	4876999		Lactobacillus_phage(100.0%)	1	NA	NA
AVG37330.1|4481597_4484378_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	28.9	6.2e-66
>prophage 327
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4488830	4496907	4876999		Burkholderia_phage(40.0%)	8	NA	NA
AVG37335.1|4488830_4489973_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	51.9	2.1e-100
AVG37336.1|4490257_4490959_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	25.9	4.0e-06
AVG37337.1|4491020_4492436_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.0	1.5e-100
AVG37338.1|4492416_4492908_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	9.3e-34
AVG37339.1|4492879_4493794_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVG37340.1|4493972_4494884_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AVG37341.1|4494962_4495145_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVG37342.1|4495218_4496907_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	32.3	1.4e-17
>prophage 328
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4510801	4511596	4876999		Micromonas_pusilla_virus(100.0%)	1	NA	NA
AVG37361.1|4510801_4511596_+	FkbM family methyltransferase	NA	G8DDJ4	Micromonas_pusilla_virus	30.2	4.4e-09
>prophage 329
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4517336	4522684	4876999	transposase	Escherichia_phage(50.0%)	3	NA	NA
AVG37367.1|4517336_4521014_+	hypothetical protein	NA	A0A1D7XFH6	Escherichia_phage	27.0	1.1e-14
AVG37368.1|4521081_4521537_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37369.1|4521563_4522684_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 330
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4527271	4528024	4876999		Bacillus_virus(100.0%)	1	NA	NA
AVG37376.1|4527271_4528024_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.4	9.9e-27
>prophage 331
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4536046	4537635	4876999		Staphylococcus_phage(50.0%)	2	NA	NA
AVG37386.1|4536046_4536763_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	3.0e-12
AVG37387.1|4536759_4537635_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	25.5	1.6e-12
>prophage 332
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4553769	4555284	4876999		Staphylococcus_phage(100.0%)	1	NA	NA
AVG37405.1|4553769_4555284_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.5e-13
>prophage 333
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4572441	4578094	4876999		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AVG37422.1|4572441_4574109_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.2	5.1e-07
AVG37423.1|4574153_4575755_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.3	1.7e-07
AVG37424.1|4575774_4576641_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AVG37425.1|4576637_4577687_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
AVG37426.1|4577704_4578094_+	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.2	7.7e-07
>prophage 334
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4588089	4594724	4876999	tRNA	Klosneuvirus(33.33%)	7	NA	NA
AVG37434.1|4588089_4589823_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.5	1.7e-85
AVG37435.1|4590062_4590623_+	VOC family protein	NA	NA	NA	NA	NA
AVG37436.1|4590701_4591445_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVG37437.1|4591706_4592678_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVG37438.1|4592674_4593418_-|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	F5B419	Synechococcus_phage	30.9	2.7e-24
AVG37439.1|4593458_4593854_-	hypothetical protein	NA	NA	NA	NA	NA
AVG37440.1|4593905_4594724_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.9	1.4e-58
>prophage 335
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4598570	4604758	4876999		Bacillus_virus(25.0%)	7	NA	NA
AVG37446.1|4598570_4599092_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AVG37447.1|4599172_4599787_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVG37448.1|4599795_4600806_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.2	8.1e-08
AVG37449.1|4600863_4601649_-	zinc ABC transporter permease	NA	NA	NA	NA	NA
AVG37450.1|4601645_4602401_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.6	6.1e-16
AVG37451.1|4602463_4603423_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG37452.1|4603438_4604758_+	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	39.7	3.4e-14
>prophage 336
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4608705	4610181	4876999		Cyanophage(100.0%)	1	NA	NA
AVG37456.1|4608705_4610181_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.0	7.8e-76
>prophage 337
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4617086	4618765	4876999		Klebsiella_phage(50.0%)	3	NA	NA
AVG37462.1|4617086_4617749_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	34.8	1.1e-05
AVG37463.1|4617773_4618424_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVG37464.1|4618534_4618765_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	9.1e-16
>prophage 338
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4622314	4636749	4876999	transposase,tail	Cronobacter_phage(25.0%)	13	NA	NA
AVG37468.1|4622314_4623058_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	47.4	1.2e-56
AVG37866.1|4623129_4623504_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	48.5	1.6e-22
AVG37469.1|4623561_4625901_+|tail	phage tail tape measure protein	tail	A0A291AXC6	Shigella_phage	48.9	1.3e-146
AVG37470.1|4625903_4626398_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	66.9	9.3e-58
AVG37471.1|4626397_4626868_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	54.5	5.6e-44
AVG37472.1|4626860_4627298_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	60.2	4.7e-45
AVG37473.1|4629567_4630688_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG37474.1|4631373_4631736_-	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	3.4e-49
AVG37475.1|4631847_4632153_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	41.6	3.9e-14
AVG37476.1|4632152_4633421_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.0	7.6e-229
AVG37477.1|4633924_4634821_-	benzoate transporter	NA	M1HZA4	Paramecium_bursaria_Chlorella_virus	33.3	4.1e-27
AVG37478.1|4634996_4635938_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AVG37479.1|4636104_4636749_+	protein-serine/threonine phosphatase	NA	Q8HA16	Enterobacteria_phage	48.6	5.6e-55
>prophage 339
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4643967	4646016	4876999		Moraxella_phage(100.0%)	1	NA	NA
AVG37486.1|4643967_4646016_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.7	5.4e-83
>prophage 340
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4652160	4652370	4876999		Morganella_phage(100.0%)	1	NA	NA
AVG37494.1|4652160_4652370_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 341
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4659802	4661362	4876999		Moraxella_phage(100.0%)	1	NA	NA
AVG37502.1|4659802_4661362_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.7e-41
>prophage 342
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4665231	4672475	4876999	tRNA	Pandoravirus(33.33%)	7	NA	NA
AVG37507.1|4665231_4666557_-	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	44.0	2.0e-46
AVG37508.1|4666618_4666810_+	YoaH family protein	NA	NA	NA	NA	NA
AVG37509.1|4666816_4667161_-	RidA family protein	NA	NA	NA	NA	NA
AVG37510.1|4667294_4669205_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.3	2.7e-89
AVG37511.1|4669271_4669967_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVG37512.1|4670004_4670586_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37513.1|4670756_4672475_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	3.9e-34
>prophage 343
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4705511	4745460	4876999	plate,transposase	Ralstonia_phage(28.57%)	37	NA	NA
AVG37541.1|4705511_4706855_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVG37542.1|4706872_4708111_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AVG37543.1|4708114_4711735_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVG37544.1|4711751_4712468_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AVG37545.1|4712479_4713496_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVG37870.1|4713571_4714096_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVG37546.1|4714099_4715599_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVG37871.1|4715732_4716362_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37547.1|4716354_4716567_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37548.1|4716555_4716771_-	hypothetical protein	NA	NA	NA	NA	NA
AVG37549.1|4717044_4717527_+	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AVG37550.1|4717594_4718002_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37551.1|4718082_4718574_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37552.1|4718570_4718924_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37553.1|4719011_4720775_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AVG37554.1|4720771_4721569_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AVG37555.1|4721585_4722584_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37556.1|4722593_4723406_+	protein of avirulence locus ImpE	NA	NA	NA	NA	NA
AVG37557.1|4723398_4723962_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVG37558.1|4723964_4725836_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVG37559.1|4725832_4726876_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVG37560.1|4726914_4729530_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.1	1.4e-80
AVG37561.1|4729554_4730973_+	serine/threonine protein kinase	NA	M1HKB5	Acanthocystis_turfacea_Chlorella_virus	27.4	1.0e-08
AVG37562.1|4730993_4731797_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37563.1|4731780_4732233_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37564.1|4732304_4734233_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.6	7.1e-45
AVG37565.1|4734244_4735039_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AVG37566.1|4735041_4736304_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AVG37567.1|4736296_4736644_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37568.1|4736843_4737815_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	43.4	1.3e-50
AVG37569.1|4737864_4738984_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG37570.1|4739491_4739941_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37571.1|4740000_4742541_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.6	3.2e-45
AVG37872.1|4742635_4743034_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37572.1|4743098_4743665_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37874.1|4744085_4744490_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37873.1|4744536_4745460_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
>prophage 344
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4751147	4752446	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG37575.1|4751147_4752446_+	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	51.6	2.0e-30
>prophage 345
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4759777	4762529	4876999		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVG37583.1|4759777_4761457_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	1.3e-23
AVG37876.1|4761581_4762529_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 346
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4765631	4769637	4876999		Pseudomonas_phage(50.0%)	5	NA	NA
AVG37587.1|4765631_4766714_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
AVG37588.1|4766713_4767544_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVG37589.1|4767540_4767933_+	siroheme synthase	NA	NA	NA	NA	NA
AVG37590.1|4767936_4768746_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37591.1|4768782_4769637_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.3	6.8e-48
>prophage 347
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4772687	4774472	4876999		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG37595.1|4772687_4774472_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.6	6.0e-14
>prophage 348
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4778553	4779342	4876999		Bacillus_virus(100.0%)	1	NA	NA
AVG37599.1|4778553_4779342_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.8e-29
>prophage 349
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4795586	4797122	4876999		Escherichia_phage(100.0%)	1	NA	NA
AVG37607.1|4795586_4797122_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.3	8.3e-20
>prophage 350
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4800607	4806965	4876999		Synechococcus_phage(33.33%)	7	NA	NA
AVG37612.1|4800607_4801450_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	49.3	2.7e-12
AVG37878.1|4801496_4801979_-	hypothetical protein	NA	NA	NA	NA	NA
AVG37613.1|4802069_4802972_+	patatin family protein	NA	NA	NA	NA	NA
AVG37614.1|4803063_4804077_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AVG37615.1|4804277_4805186_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.1	5.9e-58
AVG37616.1|4805387_4805801_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AVG37617.1|4806350_4806965_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.7	1.9e-55
>prophage 351
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4810135	4811059	4876999	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVG37619.1|4810135_4811059_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
>prophage 352
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4816240	4819139	4876999		Planktothrix_phage(33.33%)	3	NA	NA
AVG37624.1|4816240_4817254_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.2	2.6e-14
AVG37625.1|4817250_4818255_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	5.2e-15
AVG37879.1|4818302_4819139_+	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	39.8	1.0e-08
>prophage 353
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4822909	4837307	4876999	transposase,plate	Enterobacteria_phage(27.27%)	16	NA	NA
AVG37629.1|4822909_4824030_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG37630.1|4824498_4824798_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	86.9	2.5e-42
AVG37631.1|4824917_4825196_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.2	7.6e-41
AVG37632.1|4825291_4825477_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37633.1|4825479_4825668_-	hypothetical protein	NA	NA	NA	NA	NA
AVG37634.1|4825932_4826433_+	replication protein B	NA	M1SV55	Escherichia_phage	75.3	1.3e-70
AVG37635.1|4826499_4826718_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	62.1	3.8e-11
AVG37636.1|4826740_4827004_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	57.0	5.7e-22
AVG37637.1|4827005_4829303_+	replication endonuclease	NA	M1SV59	Escherichia_phage	72.9	0.0e+00
AVG37880.1|4829504_4831127_-	hypothetical protein	NA	NA	NA	NA	NA
AVG37638.1|4831488_4831671_+	hypothetical protein	NA	NA	NA	NA	NA
AVG37639.1|4832030_4832483_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.7	4.8e-45
AVG37640.1|4832622_4833939_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
AVG37641.1|4834069_4834711_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	81.2	5.6e-95
AVG37642.1|4835987_4836209_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	74.0	1.7e-27
AVG37643.1|4836317_4837307_-	hypothetical protein	NA	G9E505	Ostreococcus_lucimarinus_virus	30.4	3.6e-08
>prophage 354
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4848576	4851534	4876999		Acinetobacter_phage(100.0%)	2	NA	NA
AVG37658.1|4848576_4849935_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.6	2.5e-36
AVG37659.1|4849938_4851534_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.9	1.3e-52
>prophage 355
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4861516	4861891	4876999		Pectobacterium_phage(100.0%)	1	NA	NA
AVG37673.1|4861516_4861891_+	hypothetical protein	NA	A0A2D2W6C8	Pectobacterium_phage	84.8	9.7e-07
>prophage 356
CP026975	Enterobacter cloacae complex bacterium strain FDAARGOS_77 chromosome, complete genome	4876999	4867379	4875999	4876999	transposase	Enterobacteria_phage(27.27%)	11	NA	NA
AVG37677.1|4867379_4868499_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AVG37678.1|4868751_4870521_-	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	30.0	4.0e-34
AVG37679.1|4871595_4872876_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	50.9	1.9e-123
AVG37680.1|4872908_4873157_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
AVG37681.1|4873265_4873496_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	94.7	9.7e-34
AVG37682.1|4873504_4873744_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	43.6	2.3e-09
AVG37683.1|4873706_4874069_-	hypothetical protein	NA	G8C7S4	Escherichia_phage	94.8	1.1e-58
AVG37881.1|4874068_4874281_-	hypothetical protein	NA	A0A0N7C211	Escherichia_phage	64.7	2.8e-11
AVG37684.1|4874264_4875425_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	84.6	7.2e-194
AVG37685.1|4875421_4875574_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	44.2	1.6e-05
AVG37686.1|4875570_4875999_-	regulator	NA	M9NYX4	Enterobacteria_phage	93.7	4.9e-71
