The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	387609	458301	4077315	tRNA,head,holin,terminase,tail,capsid,protease,lysis,integrase,portal	Morganella_phage(21.74%)	85	386821:386837	424257:424273
386821:386837	attL	TACCAGAAAATAAAGTA	NA	NA	NA	NA
AUU37766.1|387609_388644_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUU37767.1|388740_389829_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	80.6	2.5e-172
AUU37768.1|390146_390560_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AUU37769.1|390689_391046_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU37770.1|391517_391763_-	pyocin activator protein PrtN	NA	A0A1W6JP35	Morganella_phage	72.2	3.3e-24
AUU40984.1|391823_392261_-	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	76.9	2.5e-62
AUU37771.1|392280_392502_-	hypothetical protein	NA	NA	NA	NA	NA
AUU37772.1|392504_393191_-	hypothetical protein	NA	R9VWB9	Serratia_phage	54.4	4.9e-65
AUU37773.1|393192_393648_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	38.6	3.5e-27
AUU37774.1|393656_394157_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	58.3	1.2e-49
AUU37775.1|394215_395043_-	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	54.3	7.2e-79
AUU37776.1|395108_395483_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.7	6.0e-41
AUU37777.1|395819_396023_-	hypothetical protein	NA	NA	NA	NA	NA
AUU37778.1|396375_397038_-	helix-turn-helix domain-containing protein	NA	A0A1R3Y604	Salmonella_virus	54.4	3.3e-18
AUU37779.1|397078_397291_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	65.2	6.6e-21
AUU37780.1|397359_397818_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
AUU37781.1|397906_398116_+	hypothetical protein	NA	NA	NA	NA	NA
AUU37782.1|398105_398285_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.9	8.1e-12
AUU37783.1|398294_399413_+	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	57.2	6.8e-48
AUU37784.1|399412_400894_+	phage N-6-adenine-methyltransferase	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	49.0	1.1e-88
AUU37785.1|400890_401283_+	hypothetical protein	NA	NA	NA	NA	NA
AUU37786.1|401282_401453_+	hypothetical protein	NA	NA	NA	NA	NA
AUU37787.1|401515_401899_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
AUU37788.1|401917_402721_+	DNA-binding protein	NA	A0A1W6JP13	Morganella_phage	63.1	9.7e-89
AUU37789.1|402717_403743_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	2.2e-85
AUU37790.1|403770_404556_+	antitermination protein	NA	F1C595	Cronobacter_phage	45.9	3.6e-64
AUU37791.1|404604_404949_+	hypothetical protein	NA	NA	NA	NA	NA
AUU37792.1|405144_405339_+	hypothetical protein	NA	NA	NA	NA	NA
AUU37793.1|405411_406434_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	77.5	1.2e-131
AUU37794.1|406497_407295_-	hypothetical protein	NA	NA	NA	NA	NA
AUU37795.1|407472_407796_+	negative regulator GrlR	NA	NA	NA	NA	NA
AUU37796.1|407792_407984_+	hypothetical protein	NA	NA	NA	NA	NA
AUU37797.1|408155_408425_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.7	5.7e-17
AUU37798.1|408424_408895_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.9	5.2e-50
AUU37799.1|409037_409520_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	83.5	1.4e-42
AUU37800.1|409759_409963_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AUU37801.1|410390_410696_+	hypothetical protein	NA	NA	NA	NA	NA
AUU37802.1|410903_411251_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	94.7	1.3e-58
AUU37803.1|411413_411887_+|terminase	phage terminase small subunit P27 family	terminase	A0A1P8DTK5	Proteus_phage	97.5	2.1e-83
AUU37804.1|411890_413624_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	97.0	0.0e+00
AUU37805.1|413633_413813_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	59.3	1.5e-10
AUU37806.1|413812_415042_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.4	1.7e-177
AUU37807.1|415013_415664_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	80.0	5.6e-95
AUU37808.1|415677_416886_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	65.2	7.7e-146
AUU37809.1|416979_417285_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	56.2	1.9e-24
AUU37810.1|417284_417611_+|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	43.9	9.0e-17
AUU37811.1|417597_417987_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	2.2e-30
AUU37812.1|417983_418388_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	58.0	2.5e-32
AUU37813.1|418399_418873_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	70.1	8.1e-59
AUU37814.1|418872_419223_+|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	42.2	1.3e-16
AUU37815.1|419267_419477_+|tail	tail assembly chaperone	tail	NA	NA	NA	NA
AUU37816.1|419481_422790_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	39.7	1.0e-168
AUU37817.1|422790_423390_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	56.0	4.7e-56
AUU37818.1|423386_423968_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-49
AUU37819.1|423991_424600_+	hypothetical protein	NA	NA	NA	NA	NA
424257:424273	attR	TACCAGAAAATAAAGTA	NA	NA	NA	NA
AUU37820.1|424656_425055_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	48.5	1.1e-32
AUU37821.1|425055_427977_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.3	7.0e-185
AUU37822.1|427979_428711_+	hypothetical protein	NA	NA	NA	NA	NA
AUU37823.1|428721_429027_+	hypothetical protein	NA	NA	NA	NA	NA
AUU37824.1|429062_430442_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	65.4	4.3e-145
AUU37825.1|430517_431114_-	hypothetical protein	NA	NA	NA	NA	NA
AUU37826.1|431801_433139_+|protease	serine protease	protease	Q2A0D0	Sodalis_phage	29.6	1.3e-29
AUU37827.1|433582_434698_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	5.8e-31
AUU37828.1|434681_435542_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
AUU37829.1|435538_436318_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AUU37830.1|436434_437478_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
AUU37831.1|437610_437928_-	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	51.6	2.5e-08
AUU37832.1|437954_439028_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUU37833.1|439027_439546_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUU37834.1|439545_442077_-	fimbrial protein FimD	NA	NA	NA	NA	NA
AUU37835.1|442113_442791_-	type 1 fimbrial chaperone protein	NA	NA	NA	NA	NA
AUU37836.1|442889_443450_-	fimbrial protein	NA	NA	NA	NA	NA
AUU37837.1|444319_445255_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
AUU37838.1|445443_446718_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	28.4	2.0e-19
AUU37839.1|447148_447742_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUU37840.1|447762_448623_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AUU37841.1|448622_449141_+	hypothetical protein	NA	NA	NA	NA	NA
AUU37842.1|449724_450003_+	BMC domain-containing protein	NA	NA	NA	NA	NA
AUU37843.1|450023_450308_+	BMC domain-containing protein	NA	NA	NA	NA	NA
AUU37844.1|450322_450601_+	BMC domain-containing protein	NA	NA	NA	NA	NA
AUU37845.1|450668_452321_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
AUU37846.1|452347_452611_+	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
AUU37847.1|452618_453767_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUU37848.1|453818_457247_+|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
AUU37849.1|457350_458301_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
>prophage 2
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	637005	645879	4077315		Caulobacter_phage(50.0%)	9	NA	NA
AUU38002.1|637005_638151_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	3.5e-31
AUU38003.1|638543_639128_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
AUU38004.1|639128_640295_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AUU38005.1|640319_640775_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AUU38006.1|640809_641835_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
AUU38007.1|641902_642481_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
AUU38008.1|642557_643133_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
AUU38009.1|643229_643910_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AUU38010.1|644310_645879_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
>prophage 3
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	1169040	1236265	4077315	tRNA,head,transposase,terminase,tail,capsid,protease,lysis,integrase,portal	Morganella_phage(18.0%)	84	1175552:1175583	1215501:1215532
AUU38414.1|1169040_1170190_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.2	5.7e-50
AUU38415.1|1170544_1172053_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38416.1|1173190_1173394_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38417.1|1173766_1174189_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38418.1|1174148_1175039_-	hypothetical protein	NA	NA	NA	NA	NA
1175552:1175583	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCC	NA	NA	NA	NA
AUU38419.1|1175673_1176846_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	65.6	4.4e-146
AUU38420.1|1176806_1177010_-	excisionase	NA	I6PBM8	Cronobacter_phage	63.9	5.9e-19
AUU38421.1|1177067_1177466_-	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	53.2	3.4e-26
AUU38422.1|1177465_1178071_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	44.6	3.5e-38
AUU38423.1|1178100_1178394_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38424.1|1178435_1178933_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	73.2	2.0e-44
AUU38425.1|1178925_1179459_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	1.5e-53
AUU38426.1|1179515_1180343_-	DUF2303 domain-containing protein	NA	A0A2R2Z323	Escherichia_phage	57.3	1.3e-80
AUU38427.1|1180408_1180783_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.7	6.0e-41
AUU38428.1|1181171_1181375_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38429.1|1181470_1182103_-	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	44.8	3.9e-40
AUU38430.1|1182205_1182397_+	cell division protein	NA	NA	NA	NA	NA
AUU38431.1|1182448_1183111_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38432.1|1183126_1183585_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
AUU38433.1|1183843_1184023_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
AUU38434.1|1184035_1185097_+	replication protein	NA	H2DE83	Erwinia_phage	54.4	5.1e-29
AUU38435.1|1185096_1185735_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	64.6	1.8e-82
AUU38436.1|1185731_1186127_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38437.1|1186199_1186583_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	52.9	2.3e-27
AUU38438.1|1186601_1187405_+	DNA-binding protein	NA	A0A1W6JP13	Morganella_phage	63.1	3.3e-89
AUU38439.1|1187401_1188427_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.7	4.4e-86
AUU38440.1|1188454_1189234_+	antitermination protein	NA	F1C595	Cronobacter_phage	47.5	3.2e-68
AUU38441.1|1189447_1189642_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38442.1|1189715_1190738_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	70.1	6.9e-132
AUU38443.1|1190924_1191248_+	negative regulator GrlR	NA	NA	NA	NA	NA
AUU38444.1|1191606_1191876_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
AUU38445.1|1191875_1192346_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	58.2	2.2e-48
AUU38446.1|1192488_1192950_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	5.0e-13
AUU38447.1|1193009_1193390_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38448.1|1193578_1193929_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	93.0	1.3e-58
AUU38449.1|1193925_1194123_+	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	86.2	4.1e-25
AUU38450.1|1194263_1194722_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	55.4	2.1e-27
AUU38451.1|1194724_1196455_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	61.0	2.1e-205
AUU38452.1|1196602_1197832_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	87.8	4.8e-212
AUU38453.1|1197821_1198427_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	5.3e-87
AUU41002.1|1198442_1199672_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	82.0	3.8e-185
AUU41003.1|1199757_1200060_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	70.0	6.8e-35
AUU38454.1|1200066_1200393_+|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	44.5	2.6e-16
AUU38455.1|1200379_1200769_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	2.2e-30
AUU41004.1|1200777_1201170_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	57.9	1.2e-31
AUU38456.1|1201192_1201669_+|tail	phage tail protein	tail	Q7Y403	Yersinia_phage	75.5	6.9e-58
AUU38457.1|1201668_1202019_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	40.5	1.4e-15
AUU38458.1|1202275_1205557_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	46.1	2.8e-206
AUU38459.1|1205557_1206157_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	56.0	6.2e-56
AUU38460.1|1206153_1206735_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	4.2e-49
AUU38461.1|1206640_1207366_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38462.1|1207425_1207824_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.7	8.3e-33
AUU38463.1|1207824_1210821_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.5	7.6e-187
AUU38464.1|1210823_1211864_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38465.1|1211907_1213239_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	56.8	7.0e-116
AUU38466.1|1213254_1213923_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38467.1|1213994_1214291_-	hypothetical protein	NA	A0A1P8DTI0	Proteus_phage	86.0	1.3e-11
AUU38468.1|1214516_1215143_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38469.1|1215124_1215328_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38470.1|1215926_1216409_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.7	4.7e-30
1215501:1215532	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCC	NA	NA	NA	NA
AUU38471.1|1216565_1217000_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUU38472.1|1216992_1217286_+	RnfH family protein	NA	NA	NA	NA	NA
AUU38473.1|1217418_1217781_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUU38474.1|1217894_1219556_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AUU38475.1|1219641_1220541_-	NAD(+) kinase	NA	NA	NA	NA	NA
AUU38476.1|1220642_1221254_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUU38477.1|1221345_1222026_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.2	1.7e-57
AUU38478.1|1222124_1222349_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38479.1|1222360_1222744_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	2.0e-31
AUU38480.1|1222894_1224250_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.1	1.8e-42
AUU38481.1|1224518_1225277_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AUU38482.1|1225577_1226156_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AUU38483.1|1226157_1226817_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AUU38484.1|1226865_1227837_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AUU38485.1|1227849_1228314_+	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AUU38486.1|1228634_1230431_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
AUU38487.1|1230445_1231417_+	signal peptidase I	NA	NA	NA	NA	NA
AUU38488.1|1231612_1232293_+	ribonuclease 3	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
AUU38489.1|1232289_1233198_+	GTPase Era	NA	NA	NA	NA	NA
AUU38490.1|1233210_1233951_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AUU38491.1|1234020_1234752_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AUU38492.1|1234751_1235132_+	holo-ACP synthase	NA	NA	NA	NA	NA
AUU38493.1|1235161_1235422_-	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	4.6e-16
AUU38494.1|1235734_1236265_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
>prophage 4
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	1321504	1369761	4077315	holin,head,tail,terminase,lysis	Morganella_phage(24.0%)	76	NA	NA
AUU38563.1|1321504_1322680_+	DUF4102 domain-containing protein	NA	G3CFG6	Escherichia_phage	76.3	1.3e-182
AUU38564.1|1322657_1322849_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38565.1|1322858_1323053_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	90.6	7.9e-29
AUU38566.1|1323060_1323663_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	57.6	2.1e-59
AUU38567.1|1323649_1324018_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38568.1|1324341_1324833_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38569.1|1324825_1325119_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38570.1|1325189_1325444_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38571.1|1325506_1325962_-	ASCH domain-containing protein	NA	M1F3E2	Salmonella_phage	26.8	1.9e-12
AUU38572.1|1325964_1326144_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38573.1|1326171_1326372_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38574.1|1326476_1327061_-	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	56.5	4.8e-53
AUU38575.1|1327057_1327738_-	ATP-binding protein	NA	K7PMI2	Enterobacteria_phage	63.3	2.8e-81
AUU38576.1|1327744_1328413_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.4	8.8e-19
AUU38577.1|1328414_1328735_-	hypothetical protein	NA	NA	NA	NA	NA
AUU41006.1|1328883_1329336_-	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	73.2	1.2e-64
AUU38578.1|1329350_1329614_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38579.1|1329830_1330091_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38580.1|1330182_1330428_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	45.1	1.9e-11
AUU38581.1|1330446_1330635_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38582.1|1330659_1330902_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38583.1|1331025_1332381_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38584.1|1332414_1332669_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38585.1|1333021_1333741_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	54.2	3.1e-62
AUU38586.1|1333847_1334060_+	transcriptional regulator	NA	A0A2D1GLN0	Escherichia_phage	68.1	1.1e-18
AUU38587.1|1334251_1334599_+	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	35.4	3.4e-06
AUU38588.1|1334688_1335375_+	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	67.2	1.1e-75
AUU38589.1|1335371_1335734_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	36.6	7.4e-12
AUU41007.1|1336439_1337114_+	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	86.2	6.4e-110
AUU38590.1|1337131_1337362_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38591.1|1337381_1337612_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38592.1|1337819_1338032_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38593.1|1338031_1338256_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38594.1|1338252_1338462_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38595.1|1338463_1338652_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
AUU41008.1|1338665_1338866_+	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	59.1	4.8e-13
AUU38596.1|1338867_1339314_+	protein ninB	NA	A0A1W6JNZ4	Morganella_phage	56.7	8.2e-37
AUU38597.1|1339334_1339694_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38598.1|1339967_1340588_+	hypothetical protein	NA	A0A2I7RAC0	Vibrio_phage	53.6	5.1e-45
AUU38599.1|1340587_1340803_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38600.1|1340799_1341303_+	DUF1133 domain-containing protein	NA	A0A1P8DTF1	Proteus_phage	87.4	1.5e-79
AUU38601.1|1342052_1342820_+	DNA-binding protein	NA	G9BW66	Planktothrix_phage	35.0	1.3e-18
AUU41009.1|1342972_1343269_+|holin	holin	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
AUU38602.1|1343265_1343670_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.0	1.3e-25
AUU38603.1|1343666_1344122_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	64.3	3.1e-39
AUU38604.1|1344563_1345346_+	DNA-binding protein	NA	K7PH51	Enterobacterial_phage	43.4	4.2e-52
AUU38605.1|1345326_1345686_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38606.1|1345864_1346050_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	70.5	4.9e-20
AUU38607.1|1346066_1346492_+	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	63.6	1.1e-33
AUU38608.1|1346475_1347792_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	84.6	1.3e-223
AUU38609.1|1347791_1349147_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	62.0	5.2e-159
AUU38610.1|1349097_1350027_+|head	phage head morphogenesis protein	head	A0A1V0E5Q2	Salmonella_phage	55.7	1.3e-89
AUU38611.1|1350030_1351305_+	hypothetical protein	NA	G0ZND7	Cronobacter_phage	64.2	2.6e-152
AUU38612.1|1351304_1351754_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	68.5	5.7e-46
AUU38613.1|1351766_1352861_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.9	2.0e-145
AUU38614.1|1352870_1353044_+	glycoprotein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
AUU38615.1|1353100_1353499_+	hypothetical protein	NA	I6S619	Salmonella_phage	78.8	2.0e-55
AUU38616.1|1353498_1353840_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	52.4	1.2e-24
AUU38617.1|1353841_1354213_+	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	65.0	5.6e-39
AUU38618.1|1354209_1354578_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	28.7	2.0e-09
AUU38619.1|1354642_1355398_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	80.1	1.5e-107
AUU38620.1|1355447_1356140_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.9	4.0e-91
AUU41010.1|1356204_1357020_-	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	43.9	2.8e-51
AUU38621.1|1357090_1357267_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	67.3	4.2e-13
AUU38622.1|1357373_1357718_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	30.8	6.4e-05
AUU38623.1|1357883_1358258_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38624.1|1358329_1361497_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	42.0	1.2e-102
AUU38625.1|1361512_1361722_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38626.1|1361689_1362007_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38627.1|1362152_1362482_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	70.6	2.8e-42
AUU38628.1|1362478_1363177_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.2	2.0e-114
AUU41011.1|1363180_1363900_+|tail	phage tail protein	tail	A0A1W6JNU8	Morganella_phage	74.5	6.2e-111
AUU38629.1|1363836_1364403_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	5.3e-49
AUU38630.1|1364402_1368125_+	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	63.9	0.0e+00
AUU38631.1|1368140_1369526_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	67.6	4.5e-150
AUU38632.1|1369530_1369761_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	94.7	1.8e-32
>prophage 5
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	1474198	1490647	4077315	holin,lysis	Burkholderia_phage(28.57%)	21	NA	NA
AUU38718.1|1474198_1475014_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	3.5e-54
AUU38719.1|1475394_1475694_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
AUU38720.1|1475696_1476101_+	structural protein	NA	A0A0A0RQM4	Escherichia_phage	47.9	2.2e-25
AUU38721.1|1476097_1476547_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AUU38722.1|1476583_1477096_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38723.1|1477104_1478592_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	5.4e-77
AUU38724.1|1478602_1479055_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38725.1|1479114_1479573_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
AUU38726.1|1479655_1481959_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
AUU38727.1|1481961_1482450_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38728.1|1482461_1482782_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38729.1|1482750_1483563_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
AUU38730.1|1483565_1484258_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
AUU38731.1|1484254_1484599_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38732.1|1484591_1485779_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
AUU38733.1|1485775_1486432_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
AUU38734.1|1486437_1487730_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.6e-14
AUU38735.1|1487843_1488023_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AUU38736.1|1488591_1489134_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	1.6e-18
AUU38737.1|1489249_1490026_-	diguanylate cyclase	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
AUU38738.1|1490029_1490647_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
>prophage 6
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	1678634	1723818	4077315	terminase,tail,holin	Escherichia_phage(25.71%)	49	NA	NA
AUU38897.1|1678634_1680101_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
AUU38898.1|1680185_1681763_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AUU38899.1|1681983_1683180_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	61.9	3.6e-140
AUU38900.1|1683187_1683376_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38901.1|1683375_1683573_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	3.4e-19
AUU38902.1|1683575_1684223_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	61.6	5.1e-72
AUU38903.1|1684272_1684992_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38904.1|1685077_1685611_-	hypothetical protein	NA	J9Q748	Salmonella_phage	45.7	5.2e-38
AUU38905.1|1685610_1686105_-	ASCH domain-containing protein	NA	A0A077KCB2	Edwardsiella_phage	27.2	2.4e-13
AUU38906.1|1686104_1686386_-	hypothetical protein	NA	A0A1P8DTG9	Proteus_phage	92.5	8.5e-48
AUU38907.1|1686422_1686617_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38908.1|1686670_1686928_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUU38909.1|1686971_1688012_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	50.4	9.3e-100
AUU38910.1|1688057_1689782_-	DNA breaking-rejoining protein	NA	A0A0U2I1R6	Escherichia_phage	48.0	1.2e-112
AUU38911.1|1690178_1690787_-	DNA-binding protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
AUU38912.1|1690897_1691143_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38913.1|1691284_1691506_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	48.3	8.5e-11
AUU38914.1|1691483_1692443_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	57.6	1.9e-70
AUU38915.1|1692411_1692894_+	replication protein	NA	NA	NA	NA	NA
AUU38916.1|1693116_1693530_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38917.1|1693526_1693922_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	8.9e-35
AUU38918.1|1693985_1694222_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38919.1|1694285_1694624_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.3	1.3e-29
AUU38920.1|1694663_1696514_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	39.1	8.5e-120
AUU38921.1|1696573_1697143_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	2.0e-43
AUU38922.1|1697142_1698627_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.8	9.5e-231
AUU38923.1|1698812_1699025_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38924.1|1699034_1700699_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	65.2	1.8e-198
AUU38925.1|1700695_1701010_+	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
AUU38926.1|1701027_1701705_+	peptidase	NA	T1SAP9	Salmonella_phage	64.3	6.8e-43
AUU38927.1|1701720_1702701_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
AUU38928.1|1702759_1703191_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	53.4	9.4e-30
AUU38929.1|1703199_1703541_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38930.1|1703594_1704200_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.2	1.8e-66
AUU38931.1|1704199_1706662_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.1	0.0e+00
AUU38932.1|1706645_1707134_+	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.2	5.1e-48
AUU38933.1|1707133_1707682_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	59.6	5.9e-45
AUU38934.1|1707684_1710768_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.2	1.0e-162
AUU38935.1|1710767_1714151_+	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.4	3.1e-184
AUU38936.1|1714237_1715305_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38937.1|1715329_1715581_-	hypothetical protein	NA	NA	NA	NA	NA
AUU38938.1|1715754_1717908_+	hypothetical protein	NA	G9L6E4	Escherichia_phage	56.6	8.2e-66
AUU38939.1|1717972_1719826_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	40.6	1.8e-114
AUU38940.1|1720012_1720384_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	5.1e-16
AUU38941.1|1720380_1720653_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
AUU38942.1|1720655_1721114_+	structural protein	NA	A0A0D4DAE2	Escherichia_phage	50.4	4.0e-31
AUU38943.1|1721129_1721624_+	hypothetical protein	NA	NA	NA	NA	NA
AUU38944.1|1722002_1722782_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.7	4.8e-32
AUU38945.1|1722765_1723818_+	nucleotidyltransferase	NA	A0A067XQU1	Caulobacter_phage	23.1	1.6e-06
>prophage 7
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2061723	2071715	4077315		Escherichia_phage(66.67%)	9	NA	NA
AUU39261.1|2061723_2064168_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	3.1e-218
AUU39262.1|2064179_2064797_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
AUU39263.1|2064798_2065659_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
AUU39264.1|2065798_2066410_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.5	8.1e-27
AUU39265.1|2066462_2066924_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
AUU39266.1|2066923_2067610_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AUU39267.1|2067859_2067943_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUU39268.1|2067945_2069646_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUU39269.1|2069657_2071715_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
>prophage 8
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2320694	2337341	4077315	head,tail,terminase,capsid,protease,lysis,portal	Salmonella_phage(12.5%)	23	NA	NA
AUU39489.1|2320694_2321093_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
AUU39490.1|2321124_2321430_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39491.1|2321441_2322023_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-52
AUU39492.1|2322022_2322619_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	4.6e-51
AUU39493.1|2322619_2325895_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	45.6	6.4e-54
AUU39494.1|2326021_2326213_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AUU39495.1|2326237_2326516_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
AUU39496.1|2326512_2326929_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39497.1|2326993_2327659_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39498.1|2327668_2328010_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AUU39499.1|2328015_2328489_-	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
AUU39500.1|2328478_2328808_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AUU39501.1|2328807_2329107_-	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
AUU39502.1|2329145_2330312_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	2.8e-169
AUU39503.1|2330315_2330984_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
AUU39504.1|2331001_2332270_-|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
AUU39505.1|2332266_2334003_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.5	6.9e-148
AUU39506.1|2333956_2334424_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
AUU39507.1|2334547_2334760_-	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
AUU39508.1|2334762_2335101_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
AUU39509.1|2335997_2336459_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
AUU39510.1|2336601_2337072_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
AUU39511.1|2337071_2337341_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
>prophage 9
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2341645	2352760	4077315	integrase	Morganella_phage(28.57%)	17	2336868:2336881	2352353:2352366
2336868:2336881	attL	TTTGTAATAACGCA	NA	NA	NA	NA
AUU39517.1|2341645_2341858_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
AUU39518.1|2342200_2342599_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
AUU39519.1|2342626_2343652_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
AUU39520.1|2343651_2344359_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
AUU39521.1|2344530_2345622_-	replication protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
AUU39522.1|2345634_2345814_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
AUU39523.1|2345803_2346013_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39524.1|2346102_2346561_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
AUU39525.1|2346645_2346885_-	transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
AUU39526.1|2346988_2347471_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
AUU39527.1|2347913_2348096_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39528.1|2348119_2348494_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
AUU39529.1|2348559_2349387_+	DUF2303 domain-containing protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
AUU39530.1|2349443_2349974_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
AUU39531.1|2350035_2350278_+	excisionase	NA	NA	NA	NA	NA
AUU39532.1|2350258_2351386_+|integrase	integrase	integrase	O21925	Phage_21	60.6	3.7e-126
AUU39533.1|2351506_2352760_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
2352353:2352366	attR	TTTGTAATAACGCA	NA	NA	NA	NA
>prophage 10
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2500983	2579912	4077315	tRNA,plate,protease	Bacillus_phage(17.65%)	58	NA	NA
AUU41028.1|2500983_2501415_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUU39658.1|2501422_2503198_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUU41029.1|2503161_2504199_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUU39659.1|2504203_2505472_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AUU39660.1|2505473_2506025_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUU39661.1|2506017_2507385_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUU39662.1|2507377_2508133_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39663.1|2508141_2510853_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	4.9e-84
AUU39664.1|2510856_2511645_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUU39665.1|2511646_2512297_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AUU39666.1|2512302_2513766_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUU39667.1|2513768_2517317_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AUU39668.1|2517354_2518710_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39669.1|2518702_2520439_+	type VI secretion protein	NA	NA	NA	NA	NA
AUU39670.1|2520529_2521003_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUU39671.1|2521095_2521746_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUU39672.1|2521795_2522344_-	DUF882 domain-containing protein	NA	NA	NA	NA	NA
AUU39673.1|2522675_2524391_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AUU39674.1|2524733_2525447_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AUU39675.1|2525852_2526506_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
AUU39676.1|2526787_2531245_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AUU39677.1|2531241_2531973_-	condensin subunit E	NA	NA	NA	NA	NA
AUU39678.1|2531953_2533276_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AUU39679.1|2533285_2534059_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AUU39680.1|2534438_2535269_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AUU39681.1|2535391_2536153_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUU39682.1|2536157_2536337_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39683.1|2536751_2536967_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AUU39684.1|2537462_2538464_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUU39685.1|2538460_2540206_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
AUU39686.1|2540242_2542612_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.7	2.7e-22
AUU39687.1|2543020_2543308_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
AUU39688.1|2543372_2545046_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AUU39689.1|2545227_2545905_-	cytidylate kinase	NA	NA	NA	NA	NA
AUU39690.1|2546193_2547480_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUU39691.1|2547676_2548765_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
AUU39692.1|2548901_2550332_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.4	7.5e-07
AUU39693.1|2550468_2551734_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
AUU39694.1|2551808_2552846_-	L-asparaginase 2	NA	NA	NA	NA	NA
AUU39695.1|2553073_2554831_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
AUU39696.1|2555500_2556355_+	formate transporter FocA	NA	NA	NA	NA	NA
AUU39697.1|2556409_2558692_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
AUU39698.1|2558799_2559540_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
AUU39699.1|2559897_2560803_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39700.1|2560875_2561925_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AUU39701.1|2562325_2562658_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39702.1|2562837_2564127_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
AUU41030.1|2564259_2565609_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
AUU39703.1|2565619_2566225_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUU39704.1|2566337_2570132_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
AUU39705.1|2570259_2570754_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AUU39706.1|2571296_2572256_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	3.4e-64
AUU39707.1|2572397_2574167_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.7	1.0e-21
AUU39708.1|2574169_2575921_+	thiol reductant ABC exporter subunit CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
AUU39709.1|2575922_2576615_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUU39710.1|2576934_2577153_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUU39711.1|2577272_2579567_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
AUU39712.1|2579597_2579912_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
>prophage 11
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2745865	2798721	4077315	tRNA,head,tail,terminase,lysis	Morganella_phage(54.05%)	61	NA	NA
AUU39852.1|2745865_2747533_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
AUU39853.1|2747777_2747918_+	hypothetical protein	NA	A0A1P8DTI0	Proteus_phage	93.5	7.2e-16
AUU39854.1|2748407_2748950_+	F17 fimbrial protein	NA	NA	NA	NA	NA
AUU41035.1|2749015_2749741_+	molecular chaperone	NA	NA	NA	NA	NA
AUU39855.1|2749750_2752285_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AUU39856.1|2752294_2753377_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUU39857.1|2753477_2753783_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU39858.1|2754486_2754747_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
AUU39859.1|2754763_2755030_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39860.1|2755026_2755713_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39861.1|2755712_2756045_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39862.1|2756034_2760180_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.5	0.0e+00
AUU39863.1|2760179_2760746_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	76.7	3.1e-49
AUU39864.1|2760682_2761402_-|tail	phage tail protein	tail	A0A1W6JNU8	Morganella_phage	74.5	1.4e-110
AUU39865.1|2761405_2762104_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	82.8	2.6e-114
AUU39866.1|2762100_2762430_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
AUU39867.1|2762573_2762885_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39868.1|2762886_2763087_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39869.1|2763102_2766438_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	45.4	2.5e-207
AUU39870.1|2766502_2766811_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39871.1|2766913_2768062_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39872.1|2768062_2769265_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39873.1|2769501_2770227_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	56.8	1.4e-65
AUU39874.1|2771270_2772044_+	helix-turn-helix domain-containing protein	NA	A2I308	Vibrio_virus	30.8	2.3e-10
AUU39875.1|2772166_2773156_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	46.4	1.3e-71
AUU39876.1|2773316_2774009_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.1	7.6e-90
AUU39877.1|2774058_2774814_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	77.3	9.1e-105
AUU39878.1|2774878_2775250_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	3.3e-47
AUU39879.1|2775246_2775615_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	82.8	1.4e-50
AUU39880.1|2775617_2775959_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	79.6	6.9e-52
AUU39881.1|2775960_2776338_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
AUU39882.1|2776380_2777331_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.1	1.3e-153
AUU39883.1|2777336_2778023_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
AUU39884.1|2778097_2779162_-|head	phage head morphogenesis protein	head	A0A1W6JNT7	Morganella_phage	51.1	6.0e-102
AUU39885.1|2779170_2780547_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.6	9.1e-212
AUU39886.1|2780548_2782033_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.7	4.7e-270
AUU39887.1|2782035_2782644_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.2e-64
AUU39888.1|2782826_2783033_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39889.1|2783962_2784424_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	46.9	2.8e-24
AUU39890.1|2784566_2785037_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
AUU39891.1|2785036_2785306_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
AUU39892.1|2785359_2785782_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39893.1|2786197_2787124_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUU39894.1|2787227_2787563_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AUU39895.1|2788078_2788462_-	antitermination protein	NA	A0A088CD47	Shigella_phage	72.2	5.5e-50
AUU39896.1|2788461_2789421_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	56.7	8.9e-105
AUU39897.1|2789383_2791021_-	ATP-dependent helicase	NA	A0A0N7KZV6	Escherichia_phage	68.1	4.3e-208
AUU41036.1|2791023_2791473_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39898.1|2791715_2792075_-	hypothetical protein	NA	A0A088C4S1	Shewanella_sp._phage	41.8	4.2e-07
AUU39899.1|2792162_2792510_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39900.1|2792673_2792883_-	XRE family transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
AUU39901.1|2792965_2793649_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	98.7	3.0e-131
AUU39902.1|2793850_2794819_+	hypothetical protein	NA	Q8HA04	Enterobacteria_phage	34.2	8.2e-42
AUU39903.1|2795239_2795557_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	9.3e-19
AUU39904.1|2795565_2795772_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39905.1|2795768_2795981_-	hypothetical protein	NA	NA	NA	NA	NA
AUU39906.1|2796376_2796637_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39907.1|2796857_2797133_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39908.1|2797278_2797599_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39909.1|2797600_2798212_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	69.2	1.1e-73
AUU39910.1|2798211_2798721_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	57.3	4.9e-54
>prophage 12
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2837752	2849706	4077315		Mycobacterium_phage(25.0%)	12	NA	NA
AUU39945.1|2837752_2838964_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
AUU41038.1|2839162_2839426_+	hypothetical protein	NA	NA	NA	NA	NA
AUU39946.1|2839777_2840422_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AUU39947.1|2840523_2841489_+	lipoyl synthase	NA	NA	NA	NA	NA
AUU39948.1|2841504_2841879_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
AUU39949.1|2842947_2843190_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	6.9e-22
AUU39950.1|2843353_2843827_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AUU39951.1|2844108_2844333_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
AUU39952.1|2844344_2844749_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
AUU39953.1|2844777_2846904_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
AUU39954.1|2846929_2847898_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	4.6e-133
AUU39955.1|2848506_2849706_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 13
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	3029146	3102054	4077315	transposase,protease	Sodalis_phage(16.67%)	59	NA	NA
AUU40102.1|3029146_3030070_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.0	7.3e-56
AUU40103.1|3030090_3030558_-	hypothetical protein	NA	NA	NA	NA	NA
AUU40104.1|3030541_3030748_-	hypothetical protein	NA	NA	NA	NA	NA
AUU40105.1|3030990_3031191_+	hypothetical protein	NA	NA	NA	NA	NA
AUU40106.1|3031441_3033496_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.9	7.4e-40
AUU40107.1|3033505_3034042_-	hypothetical protein	NA	NA	NA	NA	NA
AUU40108.1|3034089_3034794_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
AUU40109.1|3035076_3035595_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
AUU40110.1|3035844_3037140_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUU40111.1|3037266_3037551_-	hypothetical protein	NA	NA	NA	NA	NA
AUU40112.1|3037540_3038131_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
AUU40113.1|3038045_3038675_-	hypothetical protein	NA	NA	NA	NA	NA
AUU40114.1|3038655_3040305_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AUU40115.1|3040319_3041672_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	53.5	6.6e-122
AUU40116.1|3041883_3042315_+	hypothetical protein	NA	NA	NA	NA	NA
AUU40117.1|3042392_3043280_-	ParA family protein	NA	NA	NA	NA	NA
AUU40118.1|3043727_3043976_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
AUU40119.1|3044195_3044468_-	hypothetical protein	NA	NA	NA	NA	NA
AUU40120.1|3044694_3044964_-	hypothetical protein	NA	NA	NA	NA	NA
AUU40121.1|3044967_3045546_-	hypothetical protein	NA	NA	NA	NA	NA
AUU41042.1|3045582_3046323_-	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
AUU40122.1|3047162_3049325_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
AUU41043.1|3049388_3050717_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
AUU40123.1|3050846_3051524_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUU40124.1|3051914_3052835_-	hypothetical protein	NA	NA	NA	NA	NA
AUU40125.1|3052857_3053553_-	endoxylanase	NA	NA	NA	NA	NA
AUU40126.1|3054000_3054555_-	flavodoxin family protein	NA	NA	NA	NA	NA
AUU41044.1|3054626_3055313_-	hypothetical protein	NA	S4TRP0	Salmonella_phage	29.7	3.3e-05
AUU40127.1|3057053_3057362_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU40128.1|3058028_3059288_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUU40129.1|3059307_3061470_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	8.0e-29
AUU40130.1|3061494_3062748_-	transporter	NA	NA	NA	NA	NA
AUU41045.1|3062852_3064790_-	hemolysin activation protein	NA	NA	NA	NA	NA
AUU40131.1|3069858_3070164_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU40132.1|3070805_3071597_+	transcriptional regulator	NA	NA	NA	NA	NA
AUU40133.1|3071570_3072428_-	hypothetical protein	NA	NA	NA	NA	NA
AUU40134.1|3072766_3073918_-	adhesin	NA	NA	NA	NA	NA
AUU40135.1|3073930_3074467_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUU40136.1|3074466_3075000_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUU40137.1|3074992_3075421_-	fimbrial protein	NA	NA	NA	NA	NA
AUU40138.1|3075452_3076184_-	fimbrial protein	NA	NA	NA	NA	NA
AUU40139.1|3076219_3078742_-	fimbrial assembly protein	NA	NA	NA	NA	NA
AUU40140.1|3078802_3079375_-	fimbrial protein	NA	NA	NA	NA	NA
AUU40141.1|3079563_3080124_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUU40142.1|3080268_3080553_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU40143.1|3081193_3082018_+	hypothetical protein	NA	NA	NA	NA	NA
AUU40144.1|3082014_3082467_+	hypothetical protein	NA	NA	NA	NA	NA
AUU40145.1|3082629_3083598_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
AUU40146.1|3083716_3085138_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AUU40147.1|3085163_3087881_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
AUU40148.1|3087873_3088518_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
AUU40149.1|3088573_3089959_+	porin	NA	NA	NA	NA	NA
AUU40150.1|3090327_3091584_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AUU40151.1|3091577_3092462_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU40152.1|3092928_3094878_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUU40153.1|3094951_3095368_-	hypothetical protein	NA	NA	NA	NA	NA
AUU40154.1|3095524_3097489_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUU40155.1|3097795_3099760_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUU40156.1|3099990_3102054_+|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 14
CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	3482549	3537408	4077315	tRNA,protease	uncultured_Mediterranean_phage(20.0%)	58	NA	NA
AUU40467.1|3482549_3483059_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.2	2.0e-23
AUU40468.1|3483065_3483707_-	stringent starvation protein A	NA	NA	NA	NA	NA
AUU40469.1|3484341_3484734_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AUU40470.1|3484749_3485178_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AUU40471.1|3485627_3486746_-	cell division protein ZapE	NA	NA	NA	NA	NA
AUU40472.1|3486948_3487353_+	cytochrome D ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUU40473.1|3487586_3488978_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	3.2e-23
AUU40474.1|3489169_3490240_+|protease	serine endoprotease DegS	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	36.5	3.4e-12
AUU40475.1|3490280_3491330_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
AUU40476.1|3491535_3492798_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUU40477.1|3492846_3493101_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AUU40478.1|3493241_3493535_-	STAS domain-containing protein	NA	NA	NA	NA	NA
AUU40479.1|3493536_3494166_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
AUU40480.1|3494241_3494778_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUU40481.1|3494781_3495561_-	ABC transporter permease	NA	NA	NA	NA	NA
AUU40482.1|3495564_3496377_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	3.0e-21
AUU41049.1|3496620_3497601_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AUU40483.1|3497606_3498593_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	5.6e-38
AUU40484.1|3498620_3499178_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.1	1.1e-51
AUU40485.1|3499195_3499774_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AUU40486.1|3499754_3500288_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AUU40487.1|3500294_3501020_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AUU40488.1|3501079_3502555_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AUU40489.1|3502578_3502866_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AUU40490.1|3503021_3503489_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AUU40491.1|3503573_3504428_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
AUU40492.1|3504424_3504697_+	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AUU40493.1|3504871_3505282_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AUU40494.1|3505387_3506716_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AUU41050.1|3506902_3507463_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
AUU40495.1|3507553_3507835_-	ribonuclease inhibitor	NA	NA	NA	NA	NA
AUU40496.1|3507834_3508341_-	ribonuclease	NA	NA	NA	NA	NA
AUU40497.1|3508434_3509880_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUU40498.1|3509876_3510737_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AUU40499.1|3510733_3514537_-	TIGR02099 family protein	NA	NA	NA	NA	NA
AUU40500.1|3514581_3516051_-	ribonuclease G	NA	NA	NA	NA	NA
AUU40501.1|3516047_3516635_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUU40502.1|3516686_3517181_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUU40503.1|3517180_3518227_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUU40504.1|3518328_3519372_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.8	5.1e-05
AUU40505.1|3520058_3521033_+	oxidoreductase	NA	NA	NA	NA	NA
AUU40506.1|3521466_3521910_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUU40507.1|3521942_3522413_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AUU40508.1|3522425_3523775_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AUU40509.1|3524004_3524253_+	hypothetical protein	NA	NA	NA	NA	NA
AUU41051.1|3524242_3525688_+	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AUU40510.1|3525712_3526594_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUU40511.1|3526915_3527887_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AUU40512.1|3527907_3528204_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUU40513.1|3528244_3528457_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
AUU40514.1|3528561_3529527_-	acetyltransferase	NA	NA	NA	NA	NA
AUU40515.1|3529814_3531011_+	MFS transporter	NA	NA	NA	NA	NA
AUU40516.1|3531073_3531790_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
AUU40517.1|3531965_3533270_+	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
AUU40518.1|3533337_3534222_+	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
AUU40519.1|3534221_3535070_+	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
AUU40520.1|3535071_3536166_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.6	2.6e-20
AUU40521.1|3536655_3537408_+|protease	metalloprotease	protease	NA	NA	NA	NA
