The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025084	Serratia sp. ATCC 39006 chromosome, complete genome	4971757	1675215	1718306	4971757	head,integrase,plate,terminase,lysis,tail	Salmonella_phage(28.57%)	57	1677794:1677840	1718471:1718517
AUH06764.1|1675215_1676319_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	7.2e-58
AUH04030.1|1676329_1677583_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.9	1.2e-93
1677794:1677840	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT	NA	NA	NA	NA
AUH04031.1|1677862_1679017_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	72.0	1.7e-166
AUH04032.1|1678893_1679253_-	DNA-binding protein	NA	NA	NA	NA	NA
AUH06765.1|1679249_1679477_-	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	60.4	4.8e-09
AUH04033.1|1679537_1680242_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.7	9.6e-24
AUH04034.1|1680259_1680928_-	ATP-binding protein	NA	G9L667	Escherichia_phage	46.6	2.0e-50
AUH04035.1|1680927_1681590_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.6	8.2e-17
AUH04036.1|1681910_1683596_-	hypothetical protein	NA	H6WRX1	Salmonella_phage	35.6	5.4e-65
AUH04037.1|1683877_1684069_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUH04038.1|1684068_1684197_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
AUH04039.1|1684544_1684934_-	transcriptional regulator	NA	K7PH19	Enterobacteria_phage	63.5	9.4e-21
AUH04040.1|1685044_1685248_+	XRE family transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	61.5	1.6e-16
AUH04041.1|1685265_1685775_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	47.1	6.1e-28
AUH04042.1|1685802_1686525_+	hypothetical protein	NA	R9VWB9	Serratia_phage	53.7	4.0e-65
AUH04043.1|1686524_1687382_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	35.7	7.3e-26
AUH04044.1|1687399_1688140_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	72.0	1.3e-95
AUH04045.1|1688265_1688955_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	36.7	6.5e-09
AUH04046.1|1688947_1689706_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	68.6	3.6e-61
AUH04047.1|1689702_1691442_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	60.8	1.2e-229
AUH04048.1|1691539_1691788_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	68.1	3.0e-20
AUH04049.1|1691924_1692362_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	95.8	1.7e-74
AUH04050.1|1692354_1692540_+	hypothetical protein	NA	M9NYX8	Enterobacteria_phage	58.8	5.1e-09
AUH04051.1|1692664_1693360_+	antiterminator	NA	I6PDF8	Cronobacter_phage	47.2	8.0e-55
AUH04052.1|1693875_1694946_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	63.5	8.3e-128
AUH04053.1|1695193_1695433_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AUH04054.1|1695435_1695954_+	lysozyme	NA	I6PBN2	Cronobacter_phage	58.7	9.2e-48
AUH04055.1|1695956_1696490_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	46.4	5.7e-29
AUH04056.1|1696573_1696804_+	Ig domain protein group 1 domain protein	NA	NA	NA	NA	NA
AUH04057.1|1696872_1697055_+	hypothetical protein	NA	NA	NA	NA	NA
AUH04058.1|1697799_1699200_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.3	1.4e-188
AUH04059.1|1699204_1700656_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.1	1.6e-190
AUH06766.1|1700711_1701260_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	3.9e-49
AUH04060.1|1701312_1702515_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.7	3.9e-110
AUH04061.1|1702518_1703013_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	1.2e-49
AUH04062.1|1703024_1703966_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	75.2	5.2e-134
AUH04063.1|1704005_1704287_+	hypothetical protein	NA	NA	NA	NA	NA
AUH04064.1|1704255_1704675_+	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	60.0	9.7e-40
AUH04065.1|1704671_1705289_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	32.9	4.8e-19
AUH04066.1|1705288_1705675_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	75.8	7.5e-47
AUH04067.1|1705667_1706219_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	49.7	2.9e-44
AUH06767.1|1706224_1707376_+	DUF3383 domain-containing protein	NA	A0A0M4RD26	Salmonella_phage	80.4	2.7e-172
AUH04068.1|1707385_1707826_+	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	69.2	7.3e-54
AUH04069.1|1707829_1708276_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	52.4	1.4e-31
AUH04070.1|1708311_1708458_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	76.6	1.4e-14
AUH04071.1|1708439_1710461_+	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	66.6	6.0e-135
AUH04072.1|1710460_1711048_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	61.5	8.8e-55
AUH04073.1|1711047_1711350_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	53.0	1.8e-24
AUH04074.1|1711352_1712420_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	58.5	5.4e-119
AUH04075.1|1712421_1712886_+	hypothetical protein	NA	NA	NA	NA	NA
AUH04076.1|1713282_1713834_+	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	35.9	3.3e-11
AUH04077.1|1713891_1714647_+|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	71.6	2.5e-86
AUH04078.1|1714646_1715003_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.0	1.8e-47
AUH04079.1|1715003_1716194_+	hypothetical protein	NA	A0A2H4J5T1	uncultured_Caudovirales_phage	75.6	3.4e-162
AUH04080.1|1716190_1716871_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	79.6	5.7e-106
AUH04081.1|1716852_1717692_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	39.9	1.7e-35
AUH04082.1|1717691_1718306_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	46.1	1.1e-39
1718471:1718517	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT	NA	NA	NA	NA
>prophage 2
CP025084	Serratia sp. ATCC 39006 chromosome, complete genome	4971757	3135651	3181506	4971757	head,integrase,plate,lysis,terminase,tail	Pectobacterium_phage(57.14%)	62	3180088:3180101	3182381:3182394
AUH05163.1|3135651_3135873_+	hypothetical protein	NA	H9C151	Pectobacterium_phage	74.0	3.9e-24
AUH05164.1|3135869_3136406_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05165.1|3136408_3138484_-|tail	phage tail protein	tail	H9C1B7	Pectobacterium_phage	48.2	3.4e-162
AUH05166.1|3138555_3139407_-	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	81.8	4.7e-134
AUH05167.1|3139399_3140602_-|plate	phage baseplate protein	plate	H9C1B3	Pectobacterium_phage	80.2	2.5e-181
AUH05168.1|3140601_3140952_-	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	81.9	3.9e-50
AUH05169.1|3141013_3141616_-	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	66.1	2.4e-76
AUH05170.1|3141612_3142503_-	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	88.8	1.4e-157
AUH05171.1|3142495_3142786_-	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	81.2	1.1e-39
AUH05172.1|3142782_3143430_-	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	84.2	1.9e-79
AUH05173.1|3143432_3145160_-	lysozyme	NA	H9C1A7	Pectobacterium_phage	58.2	9.2e-177
AUH05174.1|3145204_3145693_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05175.1|3145901_3146672_-	DNA-binding protein	NA	Q71TC0	Escherichia_phage	46.9	2.5e-41
AUH05176.1|3146738_3147548_-	hypothetical protein	NA	A5VW58	Enterobacteria_phage	52.1	4.2e-55
AUH05177.1|3147615_3147795_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AUH06852.1|3147918_3148317_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AUH05178.1|3148504_3148906_-	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	75.0	1.8e-51
AUH05179.1|3148909_3149314_-	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	83.6	1.1e-59
AUH05180.1|3149320_3150478_-	DUF3383 domain-containing protein	NA	H9C1A2	Pectobacterium_phage	65.7	4.4e-143
AUH05181.1|3150485_3151010_-	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	82.1	1.2e-74
AUH05182.1|3151011_3151431_-	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	82.1	1.0e-65
AUH05183.1|3151433_3152021_-	hypothetical protein	NA	H9C199	Pectobacterium_phage	62.1	6.1e-56
AUH05184.1|3152017_3152455_-	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	85.6	1.6e-61
AUH05185.1|3152849_3153785_-	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	83.6	8.8e-150
AUH05186.1|3153802_3154309_-	hypothetical protein	NA	H9C195	Pectobacterium_phage	75.0	1.3e-62
AUH05187.1|3154308_3155508_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	80.2	5.1e-142
AUH06853.1|3155519_3156269_-|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	88.4	2.2e-119
AUH05188.1|3156318_3157710_-	hypothetical protein	NA	H9C192	Pectobacterium_phage	81.7	3.1e-223
AUH05189.1|3157712_3159353_-|terminase	terminase	terminase	H9C191	Pectobacterium_phage	94.1	0.0e+00
AUH05190.1|3159815_3160832_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	44.8	2.9e-45
AUH05191.1|3161204_3161528_+	hypothetical protein	NA	NA	NA	NA	NA
AUH05192.1|3161635_3161878_-	hypothetical protein	NA	NA	NA	NA	NA
AUH06854.1|3162005_3162449_+	hypothetical protein	NA	NA	NA	NA	NA
AUH05193.1|3162656_3163205_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05194.1|3163357_3163564_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05195.1|3163728_3164262_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	69.5	2.2e-60
AUH05196.1|3164234_3164765_-	lysozyme	NA	I6PBN2	Cronobacter_phage	59.1	4.7e-47
AUH05197.1|3164767_3165007_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AUH05198.1|3165183_3165591_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	60.0	1.0e-38
AUH05199.1|3165639_3165816_-	addiction module toxin, HicA family	NA	A0A0M3LQ86	Mannheimia_phage	60.3	1.2e-12
AUH05200.1|3165985_3166561_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	45.8	4.3e-38
AUH05201.1|3166557_3166917_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	69.2	3.0e-42
AUH05202.1|3166913_3167198_-	hypothetical protein	NA	G8C7V5	Escherichia_phage	86.0	1.2e-41
AUH05203.1|3167194_3167788_-	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	56.9	7.5e-62
AUH05204.1|3167829_3168078_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	68.1	3.0e-20
AUH05205.1|3168175_3169915_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	60.1	9.7e-227
AUH05206.1|3169911_3170670_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	68.6	3.6e-61
AUH05207.1|3170662_3171352_-	hypothetical protein	NA	H9C168	Pectobacterium_phage	47.7	5.0e-09
AUH05208.1|3171348_3171633_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUH05209.1|3171682_3172348_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	67.8	2.3e-59
AUH05210.1|3173187_3173748_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	37.1	1.5e-16
AUH05211.1|3173750_3173981_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	58.1	1.0e-19
AUH05212.1|3174083_3174476_+	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	51.6	3.5e-31
AUH05213.1|3174898_3175027_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
AUH05214.1|3175026_3175218_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUH05215.1|3175499_3177185_+	hypothetical protein	NA	H6WRX1	Salmonella_phage	35.6	7.1e-65
AUH05216.1|3177505_3178168_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.6	8.2e-17
AUH05217.1|3178167_3178836_+	ATP-binding protein	NA	G9L667	Escherichia_phage	47.0	1.5e-50
AUH05218.1|3178853_3179558_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.7	5.6e-24
AUH06855.1|3179618_3179837_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	54.3	7.6e-12
AUH05219.1|3179934_3180189_+	DNA-binding protein	NA	Q859D3	Escherichia_coli_phage	50.0	9.4e-14
3180088:3180101	attL	GGGCAACCGTGGGA	NA	NA	NA	NA
AUH05220.1|3180222_3181506_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	57.2	3.4e-144
AUH05220.1|3180222_3181506_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	57.2	3.4e-144
3182381:3182394	attR	TCCCACGGTTGCCC	NA	NA	NA	NA
>prophage 3
CP025084	Serratia sp. ATCC 39006 chromosome, complete genome	4971757	3220362	3312428	4971757	tRNA,integrase,plate,protease,tail	Escherichia_phage(22.22%)	94	3236461:3236475	3320179:3320193
AUH05258.1|3220362_3221187_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	3.3e-68
AUH06859.1|3221269_3222151_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
AUH05259.1|3222296_3222653_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
AUH05260.1|3222707_3223004_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.1e-13
AUH05261.1|3223008_3225396_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.7	2.1e-06
AUH05262.1|3225411_3226395_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	1.4e-33
AUH05263.1|3226770_3227127_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUH05264.1|3227169_3227367_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUH05265.1|3227463_3228006_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.1	7.4e-16
AUH05266.1|3228009_3229938_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	4.5e-132
AUH05267.1|3230424_3230700_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05268.1|3230881_3231673_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AUH05269.1|3231882_3233049_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
AUH05270.1|3233336_3234221_-|protease	protease HtpX	protease	NA	NA	NA	NA
AUH05271.1|3234671_3236843_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	36.4	2.5e-22
3236461:3236475	attL	GCACCAATAGCATAA	NA	NA	NA	NA
AUH05272.1|3237579_3238833_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	77.8	5.0e-15
AUH05273.1|3238934_3239591_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AUH05274.1|3239583_3240030_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUH05275.1|3240132_3241245_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUH05276.1|3241507_3243175_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
AUH05277.1|3243946_3244579_+	lysogenization regulator HflD	NA	NA	NA	NA	NA
AUH05278.1|3244712_3246083_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.0	5.9e-110
AUH06860.1|3246259_3246943_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUH05279.1|3246944_3248396_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AUH05280.1|3248456_3249578_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUH05281.1|3249737_3251006_-	peptidase T	NA	NA	NA	NA	NA
AUH05282.1|3251280_3251511_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05283.1|3251566_3253891_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
AUH05284.1|3253918_3254146_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
AUH05285.1|3254157_3254406_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
AUH05286.1|3254737_3256753_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.2	8.7e-86
AUH05287.1|3256772_3257501_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AUH06861.1|3257585_3258092_-	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AUH05288.1|3259056_3259248_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUH05289.1|3259659_3260472_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	50.4	2.9e-80
AUH05290.1|3261110_3261620_+	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	47.8	5.0e-38
AUH05291.1|3261681_3261927_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AUH05292.1|3261926_3262151_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	50.0	4.3e-10
AUH05293.1|3262247_3264512_+	replication endonuclease	NA	Q858T4	Yersinia_virus	53.3	4.8e-218
AUH05294.1|3264617_3264839_+	hypothetical protein	NA	NA	NA	NA	NA
AUH05295.1|3265577_3265781_+|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	68.7	3.4e-22
AUH05296.1|3265783_3265993_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	42.0	9.2e-07
AUH05297.1|3265976_3266486_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	61.9	3.6e-57
AUH05298.1|3266482_3266914_+	P2 LysB	NA	F1BUQ1	Erwinia_phage	32.4	4.7e-13
AUH05299.1|3267003_3267471_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	48.4	7.5e-33
AUH05300.1|3267748_3268390_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	65.9	1.1e-74
AUH05301.1|3268383_3268734_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	63.8	2.4e-36
AUH05302.1|3268738_3269647_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	74.8	2.0e-122
AUH05303.1|3269639_3270251_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	62.9	3.0e-74
AUH05304.1|3270477_3271497_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	55.9	5.2e-95
AUH05305.1|3271496_3272111_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	47.2	9.9e-41
AUH05306.1|3272248_3272680_-	FkbM family methyltransferase	NA	A0A291AUV0	Sinorhizobium_phage	33.3	1.2e-08
AUH05307.1|3272688_3273768_-	acyltransferase	NA	Q716G0	Shigella_phage	35.6	1.0e-40
AUH05308.1|3273864_3274107_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05309.1|3275301_3276459_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	45.0	2.2e-105
AUH05310.1|3276458_3277073_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	44.9	1.7e-40
AUH05311.1|3277402_3278671_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	46.2	2.8e-90
AUH05312.1|3278670_3279252_+|tail	tail fiber assembly protein	tail	A0A0M4QWM3	Salmonella_phage	53.4	2.6e-51
AUH05313.1|3279410_3280763_+	hypothetical protein	NA	NA	NA	NA	NA
AUH05314.1|3280931_3281495_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AUH05315.1|3281859_3283029_+|tail	phage tail protein	tail	S4TRX2	Salmonella_phage	80.4	1.7e-182
AUH05316.1|3283043_3283565_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.3	4.2e-77
AUH05317.1|3283629_3283920_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	67.4	1.2e-25
AUH05318.1|3283952_3284072_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.4	3.5e-11
AUH05319.1|3284052_3286380_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	41.4	2.7e-75
AUH05320.1|3286393_3286888_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	51.9	8.8e-40
AUH05321.1|3286884_3288078_+	late control D family protein	NA	Q6K1G4	Salmonella_virus	37.3	1.1e-67
AUH05322.1|3288176_3288392_+	late control protein B	NA	A0A2I8TV89	Erwinia_phage	66.7	5.9e-17
AUH05323.1|3288773_3290081_+	guanine deaminase	NA	NA	NA	NA	NA
AUH05324.1|3290318_3292088_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AUH05325.1|3292129_3292783_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	55.3	1.1e-71
AUH05326.1|3293147_3293552_+	hypothetical protein	NA	NA	NA	NA	NA
AUH05327.1|3293810_3294044_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	54.5	2.4e-16
AUH05328.1|3294166_3294868_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUH05329.1|3294870_3295263_-	amino acid-binding protein	NA	NA	NA	NA	NA
AUH05330.1|3295267_3295579_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUH05331.1|3295920_3297477_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
AUH05332.1|3297473_3298748_-	MFS transporter	NA	NA	NA	NA	NA
AUH05333.1|3298744_3299359_-	cysteine hydrolase	NA	NA	NA	NA	NA
AUH05334.1|3299355_3301239_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05335.1|3301235_3302432_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AUH05336.1|3302480_3303488_-	taurine catabolism dioxygenase TauD	NA	NA	NA	NA	NA
AUH05337.1|3303523_3305485_-	3-isopropylmalate dehydratase	NA	NA	NA	NA	NA
AUH05338.1|3305481_3305883_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05339.1|3305888_3306506_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUH05340.1|3307455_3307746_+	hypothetical protein	NA	NA	NA	NA	NA
AUH05341.1|3307896_3308298_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUH05342.1|3308674_3309127_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05343.1|3309304_3309526_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05344.1|3310131_3310479_+	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	58.3	4.6e-35
AUH05345.1|3310777_3310957_-	hypothetical protein	NA	NA	NA	NA	NA
AUH05346.1|3311299_3311578_+	Killer protein	NA	A0A2L1IV28	Escherichia_phage	59.8	4.0e-26
AUH05347.1|3311577_3311862_+	addiction module antidote protein, HigA family	NA	A0A2L1IV52	Escherichia_phage	65.9	1.5e-23
AUH05348.1|3312092_3312428_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	47.7	1.6e-21
3320179:3320193	attR	GCACCAATAGCATAA	NA	NA	NA	NA
>prophage 4
CP025084	Serratia sp. ATCC 39006 chromosome, complete genome	4971757	3921963	3930505	4971757		Bacillus_phage(50.0%)	7	NA	NA
AUH05824.1|3921963_3922653_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.9	1.1e-27
AUH05825.1|3922659_3923844_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.3e-20
AUH05826.1|3924045_3924807_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AUH05827.1|3925647_3927054_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	A0A1D7RI04	Synechococcus_phage	29.2	4.3e-31
AUH05828.1|3927240_3928146_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.3	8.5e-49
AUH05829.1|3928216_3929383_-	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	56.8	2.7e-116
AUH05830.1|3929497_3930505_-	NAD-dependent epimerase	NA	A0A218MN48	uncultured_virus	30.4	2.9e-13
>prophage 5
CP025084	Serratia sp. ATCC 39006 chromosome, complete genome	4971757	4745600	4758964	4971757	tRNA	Enterobacteria_phage(33.33%)	11	NA	NA
AUH06486.1|4745600_4746896_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	1.2e-14
AUH06487.1|4746895_4747693_-	ABC transporter permease	NA	NA	NA	NA	NA
AUH06488.1|4747695_4749057_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	28.5	8.9e-34
AUH06489.1|4749053_4750484_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	6.2e-54
AUH06490.1|4751486_4752047_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.6	2.3e-52
AUH06491.1|4752053_4752926_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.4	3.6e-36
AUH06492.1|4752951_4753815_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.4	3.8e-107
AUH06493.1|4753814_4754882_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	1.4e-98
AUH06494.1|4755121_4755499_-	transcriptional regulator	NA	NA	NA	NA	NA
AUH06495.1|4756135_4756348_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	82.4	8.9e-26
AUH06496.1|4757446_4758964_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	2.9e-86
