The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034078	Pseudomonas syringae pv. pisi str. PP1 chromosome, complete genome	5883416	2403789	2411533	5883416	tRNA	uncultured_Caudovirales_phage(71.43%)	9	NA	NA
AZG86194.1|2403789_2405070_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	4.1e-97
AZG86195.1|2405070_2406465_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AZG86196.1|2406516_2407515_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AZG86197.1|2407611_2408613_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.2	2.6e-163
AZG86198.1|2408609_2408945_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	78.4	1.2e-43
AZG86199.1|2408941_2409241_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	62.6	3.2e-29
AZG86200.1|2409240_2409603_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	62.5	3.9e-37
AZG86201.1|2409604_2409997_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	81.5	1.8e-56
AZG86202.1|2410231_2411533_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.2	4.5e-59
>prophage 2
CP034078	Pseudomonas syringae pv. pisi str. PP1 chromosome, complete genome	5883416	5224524	5307645	5883416	transposase,integrase,plate,tRNA,tail,lysis	Pseudomonas_phage(36.11%)	85	5297544:5297574	5322383:5322413
AZG88495.1|5224524_5225736_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AZG89236.1|5225839_5225941_+	hypothetical protein	NA	NA	NA	NA	NA
AZG88496.1|5225937_5227365_+	peptidase M23	NA	A8ATH6	Listeria_phage	44.7	4.2e-18
AZG88497.1|5227368_5228463_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AZG88498.1|5228524_5228875_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.4e-25
AZG88499.1|5229055_5230090_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AZG88500.1|5230223_5230652_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
AZG88501.1|5230750_5231665_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AZG88502.1|5231721_5232498_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZG88503.1|5232601_5232940_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AZG88504.1|5233061_5233709_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
AZG88505.1|5233778_5234573_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
AZG88506.1|5234815_5235238_-	OsmC family protein	NA	NA	NA	NA	NA
AZG88507.1|5235440_5236085_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AZG88508.1|5236096_5236792_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AZG88509.1|5236826_5237663_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	1.8e-69
AZG89237.1|5237659_5238709_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	58.0	5.3e-111
AZG88510.1|5238730_5239330_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	3.0e-74
AZG89238.1|5239741_5240239_-|lysis	lysis protein	lysis	A0A2H4JBH9	uncultured_Caudovirales_phage	50.0	7.7e-28
AZG88511.1|5240250_5240796_-	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	73.3	2.0e-69
AZG88512.1|5240907_5241453_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZG88513.1|5241463_5242996_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	53.8	1.8e-38
AZG88514.1|5243006_5243606_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	72.4	3.7e-85
AZG88515.1|5243593_5244634_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	70.1	5.4e-132
AZG88516.1|5244623_5245022_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	62.9	3.4e-42
AZG88517.1|5245018_5245531_-|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	73.8	1.1e-64
AZG88518.1|5245527_5246655_-|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	60.5	9.4e-114
AZG88519.1|5246658_5248083_-	hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	45.6	6.8e-109
AZG88520.1|5248079_5250239_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	39.0	4.1e-73
AZG88521.1|5250238_5250445_-	hypothetical protein	NA	NA	NA	NA	NA
AZG88522.1|5250369_5250666_-|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	76.0	4.3e-34
AZG88523.1|5250662_5251010_-|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	70.4	8.6e-42
AZG88524.1|5251070_5252567_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	80.3	1.4e-234
AZG88525.1|5252585_5252774_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	74.5	1.2e-13
AZG88526.1|5252770_5253361_-	hypothetical protein	NA	B5TK65	Pseudomonas_phage	52.0	1.1e-52
AZG88527.1|5253407_5253746_-	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	57.9	2.0e-19
AZG88528.1|5253726_5254116_-	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	76.4	2.3e-43
AZG88529.1|5254475_5254919_-	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	45.8	3.5e-24
AZG88530.1|5255030_5255720_+	helix-turn-helix domain-containing protein	NA	Q8HAG7	Salmonella_phage	47.9	1.8e-51
AZG88531.1|5255872_5256121_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
AZG88532.1|5256218_5256485_+	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	51.2	2.1e-16
AZG88533.1|5256590_5258513_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
AZG88534.1|5258584_5260066_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AZG88535.1|5260136_5260955_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AZG88536.1|5260951_5261626_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AZG88537.1|5261892_5262714_-	ABC transporter permease	NA	NA	NA	NA	NA
AZG88538.1|5262725_5263973_-	ABC transporter permease	NA	NA	NA	NA	NA
AZG88539.1|5264050_5265085_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZG88540.1|5265167_5266292_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	31.4	2.3e-27
AZG88541.1|5266755_5267385_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZG88542.1|5267381_5269394_-	PAS domain S-box protein	NA	NA	NA	NA	NA
AZG88543.1|5269508_5270513_+	DUF3530 family protein	NA	NA	NA	NA	NA
AZG88544.1|5270521_5271292_-	molecular chaperone DjlA	NA	NA	NA	NA	NA
AZG88545.1|5271292_5272015_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
AZG88546.1|5272066_5273089_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZG88547.1|5273218_5275999_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
AZG89239.1|5276015_5277302_+	molecular chaperone SurA	NA	NA	NA	NA	NA
AZG88548.1|5277298_5278288_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AZG88549.1|5278284_5279091_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AZG88550.1|5279207_5279588_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
AZG88551.1|5279587_5280463_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A291L9W7	Bordetella_phage	43.8	3.9e-06
AZG88552.1|5280486_5280807_+	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
AZG88553.1|5281094_5283017_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
AZG88554.1|5283138_5284410_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	40.4	4.9e-10
AZG88555.1|5284406_5285969_+	SpoVR family protein	NA	NA	NA	NA	NA
AZG88556.1|5286066_5287296_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.1	6.1e-82
AZG88557.1|5287415_5287940_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AZG88558.1|5287930_5288284_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AZG88559.1|5288349_5288928_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AZG88560.1|5288951_5289977_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.1	2.8e-104
AZG88561.1|5290175_5290391_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZG88562.1|5290870_5292826_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	1.8e-72
AZG88563.1|5292893_5294744_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.7	2.0e-36
AZG88564.1|5295010_5297497_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	37.0	2.2e-14
5297544:5297574	attL	ACTCATAATCCTTTGGTCCACGGTTCGAGTC	NA	NA	NA	NA
AZG88565.1|5297575_5298784_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	34.9	2.4e-46
AZG88566.1|5299303_5299522_+	DNA-binding protein	NA	NA	NA	NA	NA
AZG88567.1|5299577_5300366_+	helix-turn-helix domain-containing protein	NA	A0A2H4JAS0	uncultured_Caudovirales_phage	33.7	2.4e-07
AZG88568.1|5300429_5300672_+	conjugal transfer protein TraK	NA	NA	NA	NA	NA
AZG88569.1|5301000_5301375_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
AZG88570.1|5301415_5302171_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
AZG88571.1|5302374_5303760_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
AZG88572.1|5303827_5304052_+	hypothetical protein	NA	NA	NA	NA	NA
AZG88573.1|5304552_5305062_-	hypothetical protein	NA	NA	NA	NA	NA
AZG88574.1|5305350_5305668_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZG88575.1|5306061_5307645_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.2	5.7e-125
5322383:5322413	attR	ACTCATAATCCTTTGGTCCACGGTTCGAGTC	NA	NA	NA	NA
>prophage 3
CP034078	Pseudomonas syringae pv. pisi str. PP1 chromosome, complete genome	5883416	5379841	5411498	5883416	protease,transposase,holin	Bacillus_virus(20.0%)	23	NA	NA
AZG88634.1|5379841_5380300_-|transposase	transposase	transposase	NA	NA	NA	NA
AZG88635.1|5380424_5381528_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
AZG88636.1|5382310_5383258_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
AZG88637.1|5383325_5384171_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
AZG88638.1|5384167_5385346_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.4	2.2e-25
AZG88639.1|5385606_5386860_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.0e-100
AZG88640.1|5386877_5388128_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
AZG88641.1|5388143_5388440_+	sarcosine oxidase subunit delta family protein	NA	NA	NA	NA	NA
AZG88642.1|5388436_5391457_+	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
AZG88643.1|5391507_5392140_+	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
AZG88644.1|5392337_5393195_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AZG88645.1|5393303_5394503_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.7	2.2e-12
AZG88646.1|5395989_5397006_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	41.8	1.4e-28
AZG88647.1|5397125_5402942_-	hypothetical protein	NA	NA	NA	NA	NA
AZG88648.1|5403122_5403686_+	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
AZG88649.1|5404090_5404984_-	acyltransferase	NA	NA	NA	NA	NA
AZG88650.1|5405177_5405681_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
AZG88651.1|5405876_5406506_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AZG88652.1|5406575_5406758_-	hypothetical protein	NA	NA	NA	NA	NA
AZG88653.1|5406754_5407888_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AZG88654.1|5408009_5408993_-	FecR family protein	NA	NA	NA	NA	NA
AZG88655.1|5408989_5409508_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AZG88656.1|5409791_5411498_-|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.2	8.5e-50
