The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	296156	311988	5498578	transposase,tail,integrase	Enterobacteria_phage(31.25%)	17	290586:290598	313346:313358
290586:290598	attL	AATTTATATTATG	NA	NA	NA	NA
BAB33691.1|296156_297212_-	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
BAB33692.1|297499_298603_+	gamma-glutamate kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
BAB33693.1|298614_299868_+	gamma-glutamylphosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
BAB33695.1|300937_301183_-	phage early gene regulator	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
BAB33696.1|301422_301812_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
BAB33697.1|301939_302653_-	phage repressor protein CI	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
BAB33698.1|302753_302954_+	phage repressor Cro	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
BAB33699.1|303072_303366_+	phage regulatory protein CII	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
BAB33703.1|304628_305423_+|tail	phage tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
BAB33704.1|305422_306016_+|tail	phage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
BAB33705.1|305987_306431_-|tail	phage tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
BAB33706.1|306451_306862_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
BAB33707.1|306891_307446_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
BAB33708.1|307503_308277_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
BAB33710.1|309100_309844_+	transcription regulator	NA	NA	NA	NA	NA
BAB33711.1|309885_310239_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	70.8	1.6e-40
BAB33712.1|310806_311988_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
313346:313358	attR	CATAATATAAATT	NA	NA	NA	NA
>prophage 2
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	316503	379161	5498578	transposase,capsid,holin	Enterobacteria_phage(25.0%)	53	NA	NA
BAB33721.1|316503_317256_-|capsid	phage capsid size determining protein	capsid	NA	NA	NA	NA
BAB33722.1|318189_318450_+	transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
BAB33723.1|318446_319004_+	phage repressor protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
BAB33724.1|319000_319222_+	hypothetical protein	NA	NA	NA	NA	NA
BAB33725.1|319221_319545_+	hypothetical protein	NA	NA	NA	NA	NA
BAB33726.1|319558_321892_+	phage DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
BAB33727.1|322024_322981_-	hypothetical protein	NA	NA	NA	NA	NA
BAB33728.2|323656_324556_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
BAB33729.1|324654_325377_+	oxidoreductase	NA	NA	NA	NA	NA
BAB33730.1|325543_325822_+	putative membrane protein	NA	NA	NA	NA	NA
BAB33732.1|326524_327427_-	transcriptional regulator	NA	NA	NA	NA	NA
BAB33733.2|327672_328731_+	hypothetical protein	NA	NA	NA	NA	NA
BAB33734.2|328872_330000_+	transport protein	NA	NA	NA	NA	NA
BAB33736.1|330178_331135_-	moco insertion factor for PaoABC aldehyde oxidoreductase	NA	NA	NA	NA	NA
BAB33737.1|331144_333343_-	moco-containing subunit of PaoABC aldehyde oxidoreductase	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
BAB33738.1|333339_334296_-	FAD-containing subunit of PaoABC aldehyde oxidoreductase	NA	NA	NA	NA	NA
BAB33739.1|334292_334982_-	xanthine dehydrogenase	NA	NA	NA	NA	NA
BAB33740.1|335399_336014_+	hypothetical protein	NA	NA	NA	NA	NA
BAB33742.2|336903_337614_-	ECP production pilus chaperone	NA	NA	NA	NA	NA
BAB33743.1|337582_339226_-	polymerized tip adhesin of ECP fibers	NA	NA	NA	NA	NA
BAB33744.1|339215_341741_-	ECP production outer membrane protein	NA	NA	NA	NA	NA
BAB33745.1|341766_342435_-	ECP production pilus chaperone	NA	NA	NA	NA	NA
BAB33746.1|342492_343080_-	ECP pilin	NA	NA	NA	NA	NA
BAB33747.2|343154_343697_-	transcriptional regulator for the ecp operon	NA	NA	NA	NA	NA
BAB33749.1|344521_344713_+	hypothetical protein	NA	NA	NA	NA	NA
BBE29395.1|344782_344923_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
BAB33750.2|344922_345189_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
BAB33751.2|345449_345830_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BAB33752.1|345826_346174_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BAB33753.1|346223_347762_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BAB33754.1|348573_349716_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
BAB33755.1|349950_350871_-	hydrolase	NA	NA	NA	NA	NA
BAB33756.1|351027_351954_+	transcriptional regulator	NA	NA	NA	NA	NA
BAB33757.1|352241_352598_-	hypothetical protein	NA	NA	NA	NA	NA
BAB33758.1|352790_353366_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	4.2e-33
BAB33759.1|353931_358185_+	invasin	NA	NA	NA	NA	NA
BAB33760.2|358305_359163_-	transcriptional regulator	NA	NA	NA	NA	NA
BAB33761.1|359411_360281_+	reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.5e-53
BAB33762.1|360440_361034_-	reactive chlorine species stress resistance inner membrane protein	NA	NA	NA	NA	NA
BAB33765.2|361390_362716_-	pyridine nucleotide-dependent disulfide oxidoreductase of reactive chlorine stress species RCS resistance	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
BAB33766.1|362941_363796_+	reactive chlorine species-specific activator of the rcl genes	NA	NA	NA	NA	NA
BAB33767.1|364322_365042_+	cysteine-rich LutA family protein	NA	NA	NA	NA	NA
BAB33768.1|365052_366480_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
BAB33769.2|366472_367168_+	hypothetical protein	NA	NA	NA	NA	NA
BAB33772.2|368260_368473_-	autotransporter	NA	NA	NA	NA	NA
BAB33773.1|368426_369521_-	autotransporter	NA	NA	NA	NA	NA
BAB33774.1|369562_370324_-	hypothetical protein	NA	NA	NA	NA	NA
BAB33775.2|371104_371272_-	hypothetical protein	NA	NA	NA	NA	NA
BAB33779.1|372407_372542_+	hypothetical protein	NA	NA	NA	NA	NA
BAB33780.1|373223_374912_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	9.6e-62
BAB33781.2|374925_376398_-	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
BAB33782.1|376411_376999_-	transcriptional repressor	NA	NA	NA	NA	NA
BAB33783.1|377127_379161_+|holin	choline transporter of high affinity	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 3
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	892498	928364	5498578	protease,holin,terminase,tail	Enterobacteria_phage(45.95%)	41	NA	NA
BAB34225.1|892498_892666_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
BAB34227.2|892908_893511_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34228.1|893721_893943_-	hypothetical protein	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
BAB34229.2|894041_894257_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
BAB34230.1|894333_894525_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
BAB34231.1|894497_894680_-	hypothetical protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
BAB34232.1|894676_895357_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
BAB34235.1|896393_897017_+	recombination endonuclease	NA	Q716C3	Shigella_phage	96.1	1.6e-94
BAB34236.1|897013_897679_+	serine/threonine-specific protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
BAB34237.1|897890_898850_-	lipid A 3'-O-deacylase	NA	NA	NA	NA	NA
BAB34238.1|899324_900014_+	phage antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
BAB34239.2|900197_900941_+	membrane protein	NA	NA	NA	NA	NA
BAB34240.1|901265_901664_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
BAB34241.1|901806_902022_+|holin	phage holin protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
BAB34242.1|902021_902519_+	phage endolysin	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
BAB34243.1|902515_902983_+	phage endopeptidase	NA	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
BAB34244.1|902735_902942_+	phage lipoprotein precursor	NA	H6WRZ6	Salmonella_phage	97.1	2.6e-30
BAB34245.1|902970_903123_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
BAB34247.1|903797_904289_+|terminase	phage terminase small subunit	terminase	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
BAB34248.1|904288_906391_+|terminase	phage terminase large subunit	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
BAB34249.2|906527_907652_+	hypothetical protein	NA	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
BAB34252.2|908053_910081_+|protease	phage protease/scaffold protein	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
BAB34253.2|910167_910491_+	hypothetical protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
BAB34254.1|910483_910759_+	hypothetical protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
BAB34255.1|910770_911349_+|tail	phage minor tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
BAB34256.1|911345_911747_+|tail	phage minor tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
BAB34257.1|911757_912501_+|tail	phage major tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
BAB34258.1|912561_912948_+|tail	phage minor tail protein	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
BAB34259.1|912956_913286_+|tail	phage minor tail protein	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
BAB34260.1|913257_916323_+|tail	phage tail length tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
BAB34261.1|916322_916652_+|tail	phage minor tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
BAB34262.1|916661_917360_+|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
BAB34263.2|917365_918109_+|tail	phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
BAB34264.2|918141_918654_+|tail	phage tail assembly protein	tail	K7PH50	Enterobacteria_phage	93.5	5.1e-83
BAB34265.1|918714_922128_+	phage host specificity protein	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
BAB34266.1|922198_922798_+	outer membrane precursor Lom	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
BAB34267.1|922857_924174_+|tail	phage tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
BAB34268.2|924175_924445_+	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
BAB34269.1|924621_925602_+	T3SS secreted effector NleB	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
BAB34270.2|925635_926655_+	T3SS secreted effector NleC	NA	NA	NA	NA	NA
BAB34271.1|927482_928364_+	T3SS secreted effector NleH	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
>prophage 4
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	1159810	1311316	5498578	holin,terminase,head,lysis,capsid,portal,integrase,transposase,tRNA,protease,tail	Escherichia_phage(47.52%)	182	1182129:1182188	1271754:1272440
BAB34476.2|1159810_1160140_-|tRNA	mnm(5)-s(2)U34-tRNA 2-thiolation sulfurtransferase	tRNA	NA	NA	NA	NA
BAB34477.1|1160230_1160890_-	membrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
BAB34478.1|1161297_1162317_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
BAB34479.2|1162294_1162537_-	phage excisionase	NA	NA	NA	NA	NA
BAB34480.1|1162604_1165076_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
BAB34481.1|1165169_1165361_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34482.1|1165357_1165546_-	cell division inhibition protein	NA	NA	NA	NA	NA
BAB34484.1|1166119_1166305_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34486.1|1166491_1166881_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34487.1|1166892_1167021_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34488.1|1167022_1167178_-	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
BAB34490.1|1167455_1167743_-	plasmid stabilization system protein	NA	NA	NA	NA	NA
BAB34491.1|1167742_1167934_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34492.2|1167961_1168363_-	phage repressor protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
BAB34493.1|1168471_1168744_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
BAB34494.1|1168727_1169153_+	hypothetical protein	NA	NA	NA	NA	NA
BBE29402.1|1169359_1169815_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34496.1|1169893_1170985_+	phage replication protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
BAB34497.1|1170991_1171738_+	phage DNA replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
BAB34498.1|1171759_1172530_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
BAB34499.1|1172545_1172959_+	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
BAB34500.1|1173310_1174084_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34502.1|1174449_1174587_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
BAB34503.1|1174631_1174844_+	phage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
BAB34505.2|1175291_1176341_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
BAB34506.1|1176353_1176725_+	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
BAB34507.1|1176714_1177086_+	phage antiterminator	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
BAB34508.1|1177237_1178056_+|protease	phage CAAX amino terminal protease family protein	protease	NA	NA	NA	NA
BAB34509.1|1178342_1178582_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
BAB34510.1|1178802_1179390_+	AraC-family transcriptional regulator	NA	NA	NA	NA	NA
BAB34511.1|1180157_1182008_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
1182129:1182188	attL	TTGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGAC	NA	NA	NA	NA
BAB34512.1|1182183_1182510_+|transposase	IS629 transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BAB34513.2|1182509_1183160_+|transposase	IS629 transposase	transposase	A0A0N7C1X7	Escherichia_phage	73.2	1.6e-113
BAB34514.1|1183364_1183679_-	transcriptional regulator PchA	NA	NA	NA	NA	NA
BAB34516.2|1184144_1184669_-	endopeptidase	NA	Q7AYI6	Enterobacteria_phage	93.5	6.4e-73
BAB34515.2|1184206_1184392_-	lipoprotein precursor	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
BAB34517.1|1184613_1184727_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
BAB34519.1|1184947_1185481_-	phage endolysin	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
BAB34521.2|1185640_1185913_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34523.1|1186168_1186375_-|holin	phage holine protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
BAB34524.1|1187125_1187401_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
BAB34525.1|1187476_1187857_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BAB34526.1|1187853_1188201_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BAB34527.1|1188250_1189789_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BAB34528.1|1189838_1190081_+	phage tarminase small subunit	NA	NA	NA	NA	NA
BAB34529.2|1190016_1191981_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.0e-260
BBE29403.1|1191964_1192171_+|head,tail	phage head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
BAB34530.1|1192167_1193760_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
BAB34531.1|1193749_1195255_+|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
BAB34532.1|1195291_1195639_+|head	phage head-DNA stabilization protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
BAB34533.1|1195696_1195963_+|head	phage head protein	head	NA	NA	NA	NA
BAB34534.2|1196055_1196685_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	97.6	1.8e-106
BAB34535.2|1196698_1197130_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
BAB34536.2|1197156_1197570_+|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
BAB34537.1|1197550_1200130_+|tail	phage tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	0.0e+00
BAB34538.1|1200126_1200456_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
BAB34539.1|1200455_1201154_+|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
BAB34540.2|1201164_1201908_+|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
BAB34541.2|1201904_1202486_+|tail	phage tail assembly protein	tail	H6WZM5	Escherichia_phage	100.0	1.9e-94
BAB34543.1|1202676_1203204_-	copper/zinc-superoxide dismutase	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
BAB34544.1|1203337_1206811_+	phage host specificity protein	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
BAB34545.1|1206878_1207478_+	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
BAB34546.2|1207542_1208856_+|tail	phage tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
BAB34547.1|1208857_1209127_+	hypothetical protein	NA	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
BAB34551.1|1211400_1212519_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
BAB34552.1|1212515_1214309_+	hydrogenase 1 large subunit	NA	NA	NA	NA	NA
BAB34553.1|1214327_1215035_+	hydrogenase 1 b-type cytochrome subunit	NA	NA	NA	NA	NA
BAB34554.1|1215031_1215619_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
BAB34555.1|1215615_1216014_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
BAB34556.1|1216010_1216868_+	hydrogenase-1 protein nickel incorporation factor	NA	NA	NA	NA	NA
BAB34557.1|1217001_1218546_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
BAB34558.1|1218557_1219694_+	cytochrome bd-II oxidase subunit II	NA	NA	NA	NA	NA
BAB34559.1|1219878_1221183_+	phosphoanhydride phosphorylase	NA	NA	NA	NA	NA
BAB34560.1|1221302_1223483_-	colanic acid production tyrosine-protein kinase	NA	NA	NA	NA	NA
BAB34561.2|1223502_1223949_-	O-antigen capsule forming protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
BAB34562.1|1223936_1225076_-	O-antigen capsule outer membrane auxiliary protein export channel	NA	NA	NA	NA	NA
BAB34563.1|1225121_1227218_-	O-antigen capsule production periplasmic protein	NA	NA	NA	NA	NA
BAB34564.1|1227217_1227964_-	O-antigen capsule production periplasmic protein	NA	NA	NA	NA	NA
BAB34565.1|1227960_1228605_-	O-antigen capsule production lipoprotein	NA	NA	NA	NA	NA
BAB34566.2|1228711_1229017_-	O-antigen capsule production threonine-rich inner membrane protein	NA	NA	NA	NA	NA
BAB34568.1|1229956_1230169_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
BAB34570.1|1230783_1231857_-	electron transporter	NA	NA	NA	NA	NA
BAB34571.2|1231928_1234628_-	hybrid sensory histidine kinase in two-component regulatory system with TorR	NA	A0A1V0SGX0	Hokovirus	31.9	9.1e-38
BAB34572.1|1234755_1235784_+	periplasmic sensory protein associated with the TorRS two-component regulatory system	NA	NA	NA	NA	NA
BAB34573.1|1235756_1236449_-	two-component regulatory system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
BAB34574.1|1236578_1237751_+	trimethylamine N-oxidoreductase I cytochrome c-type subunit	NA	NA	NA	NA	NA
BAB34575.1|1237750_1240297_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
BAB34576.1|1240293_1240893_+	TorA-maturation chaperone	NA	NA	NA	NA	NA
BAB34577.1|1241046_1241352_-	modulator of CbpA co-chaperone	NA	NA	NA	NA	NA
BAB34578.1|1241351_1242272_-	DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
BAB34581.1|1244079_1245321_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
BAB34582.1|1245358_1245586_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34583.1|1246181_1247492_-|integrase	integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
BAB34584.1|1247544_1247829_-	phage excisionase	NA	G9L654	Escherichia_phage	100.0	9.1e-50
BAB34585.2|1247914_1248214_-	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
BAB34586.2|1248285_1248570_-	RNA-binding protein	NA	A0A1I9LJL9	Stx_converting_phage	100.0	9.1e-50
BAB34587.1|1248562_1249186_-	hypothetical protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
BAB34588.1|1249189_1249477_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
BAB34589.1|1249478_1249697_-	hypothetical protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
BAB34590.2|1249698_1249914_-	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
BAB34591.2|1249915_1250104_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
BAB34592.1|1250255_1251029_-	hypothetical protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
BAB34593.1|1251025_1251247_-	hypothetical protein	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
BAB34594.1|1251345_1251561_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
BAB34595.1|1251637_1251829_-	hypothetical protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
BAB34596.1|1251801_1251984_-	hypothetical protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
BAB34597.1|1251980_1252661_-	exonuclease	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
BAB34598.1|1252657_1253443_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
BAB34599.2|1253448_1253745_-	phage host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
BAB34600.2|1253819_1253963_-	phage kil protein	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
BAB34601.1|1253931_1254096_-	phage regulatory protein CIII	NA	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
BAB34602.1|1254168_1254537_-	single stranded DNA-binding protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
BAB34603.1|1254719_1254971_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
BAB34604.1|1255029_1255302_-	phage early gene regulator N	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
BBE29404.1|1255279_1255462_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
BAB34607.1|1256030_1256552_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
BAB34608.2|1257053_1257707_-	phage repressor protein CI	NA	A0A0N7BTS4	Escherichia_phage	100.0	6.2e-126
BAB34609.1|1257824_1258040_+	phage repressor protein	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
BAB34610.1|1258181_1258478_+	phage regulatory protein CII	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
BAB34611.1|1258510_1258657_+	hypothetical protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
BAB34612.1|1258649_1259549_+	replication protein O	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
BAB34613.2|1259538_1260975_+	replication protein P	NA	A0A0N7C224	Escherichia_phage	100.0	6.1e-275
BAB34614.1|1260974_1261244_+	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
BAB34615.1|1261314_1261593_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
BAB34616.1|1261725_1261941_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
BAB34617.1|1261951_1262188_+	hypothetical protein	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
BAB34618.1|1262144_1262591_+	recombination protein	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
BAB34619.1|1262587_1263115_+	DNA methylase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
BAB34622.1|1263568_1264303_+	phage antirepressor protein	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
BAB34623.1|1264377_1265100_+	hypothetical protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
BAB34624.1|1265099_1265705_+	recombination endonuclease	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
BAB34625.1|1265701_1265896_+	hypothetical protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
BAB34626.1|1265888_1266323_+	phage antiterminator Q	NA	G9L695	Escherichia_phage	100.0	2.8e-82
BAB34628.1|1267106_1268066_+	Shiga toxin 2 subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
BAB34629.1|1268077_1268347_+	Shiga toxin 2 subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
BAB34630.1|1268833_1270738_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	100.0	0.0e+00
BAB34631.2|1270544_1271432_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BAB34632.1|1271431_1271758_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBE29405.1|1271815_1272085_+	hypothetical protein	NA	A0A0N7C066	Escherichia_phage	100.0	5.4e-44
BAB34633.1|1272219_1272399_+	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
BAB34634.2|1272439_1272712_+	hypothetical protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
1271754:1272440	attR	GTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAAAAGTGGCGACAAACAACCTGAAACTGGGAACCTTTGGCGCATTTGATAACGAATGGCATACGCTGGCTTTCCGCTTTGCCGGGAATAACAGCCTGCAGGTGACGCCGGTTATTGATGGTCAGGATGGCACACCGTTCACGCTGACGCAGTCACCGGTCAGTGCCTTTGCGGCGGATAAACTGCATGTGACAGACATTACCAGAGGTGCGACTTACCCGGTACTGATAGACAGCATTGCGGTGGAAGTGAACAGCACAGACACTGCGGCATGATAAAAAAACCGCCAGCGACAGGAATGGACGCTGGCGGTGGTGATACCTATGGAGAAAAAATAAAGGAACGATACTTTCGTACTCTGGTTTTTAATGAAAACAGTTCTTATTGTCAACAATAACGGAAAGAAATTATGACATTTCTGAACCAGTTAATGCTGTACTTCTGTACGGTGGTCTGTGTGCTGTATCTCCTTTCGGGTGGGTACAGGGCCATGCGTGACTTCTGGCGCAGACAGATTGACAAAAGGGCCGCTGAGAAAATCAGCGCCAGTCAGTCAGCCGGAAGCAAACCCGAAGAGCCGCTCATTTAGCGGCAACTTTCTTAATCACACCTTTCGACGAGAAAATCCCA	NA	NA	NA	NA
BAB34635.1|1272788_1273004_+|lysis	phage lysis protein	lysis	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
BAB34636.1|1273008_1273542_+	phage endolysin	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
BAB34637.1|1273812_1274382_+	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BBE29406.1|1274381_1274528_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BAB34638.1|1274535_1275000_+	phage endopeptidase	NA	A0A1I9LJR7	Stx_converting_phage	100.0	5.8e-78
BAB34639.1|1274755_1274941_+	lipoprotein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
BAB34640.1|1275031_1275325_-	Bor protein precursor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
BAB34641.2|1275474_1275678_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
BAB34642.1|1275733_1276540_+|terminase	phage terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
BAB34643.1|1276520_1278227_+|terminase	phage terminase large subunit	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
BAB34644.1|1278226_1280371_+|portal	phage portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
BAB34645.1|1280528_1281536_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
BAB34646.1|1281559_1282774_+|capsid	phage major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
BAB34647.1|1282829_1283219_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
BAB34648.1|1283268_1283730_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
BAB34649.1|1283713_1284277_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
BAB34650.1|1284276_1284927_+	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
BAB34651.1|1284923_1286861_+|tail	phage tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
BAB34652.1|1286862_1287132_+	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
BAB34653.2|1287271_1287460_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
BAB34655.2|1287754_1289380_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
BAB34656.1|1289376_1290645_+|tail	phage tail fiber protein	tail	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
BAB34657.1|1290659_1290938_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
BAB34658.1|1290943_1291561_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
BAB34659.1|1291651_1292386_+	outer membrane precursor protein Lom	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
BAB34660.1|1292815_1293217_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
BAB34661.1|1293310_1293967_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
BAB34662.1|1293969_1294416_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
BAB34663.1|1294425_1294677_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
BAB34664.1|1294687_1295953_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
BAB34665.1|1296022_1304404_+	hypothetical protein	NA	A0A0N7C080	Escherichia_phage	100.0	0.0e+00
BAB34667.1|1304954_1305299_-	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
BAB34668.1|1305418_1305631_-	regulatory protein MokC for HokC	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
BAB34669.1|1305864_1306260_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
BAB34670.1|1306259_1306919_-	hypothetical protein	NA	A0A1I9LJU9	Stx_converting_phage	100.0	5.3e-125
BAB34671.1|1306939_1307158_-	hypothetical protein	NA	A0A1I9LJV0	Stx_converting_phage	100.0	4.4e-36
BAB34672.1|1307144_1307429_-	hypothetical protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
BAB34673.1|1307425_1307647_-	hypothetical protein	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
BAB34674.1|1307694_1308324_-	phage antirepressor	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
BAB34675.2|1309472_1310801_-	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
BAB34676.2|1310821_1311316_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
>prophage 5
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	1370771	1442236	5498578	integrase,transposase	Stx2-converting_phage(19.23%)	70	1364941:1364956	1382841:1382856
1364941:1364956	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
BAB34722.1|1370771_1371974_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
BAB34723.1|1372160_1373978_-	membrane protein	NA	NA	NA	NA	NA
BAB34725.1|1375089_1375386_+	regulatory protein	NA	NA	NA	NA	NA
BAB34726.1|1376028_1377414_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34727.1|1378234_1378798_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34728.1|1378952_1381313_+	IS-excision enhancer IEE	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
BAB34730.1|1382069_1383608_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
1382841:1382856	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
BAB34731.1|1383657_1384005_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BAB34732.2|1384001_1384382_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
BAB34734.1|1384908_1385727_+|transposase	IS600 transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	6.9e-66
BAB34735.2|1385839_1386379_+	complement resistance protein precursor TraT	NA	NA	NA	NA	NA
BAB34736.1|1386426_1386678_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34737.1|1386701_1386992_-	restriction endonuclease	NA	NA	NA	NA	NA
BAB34739.1|1387677_1388037_+	diacylglycerol kinase	NA	NA	NA	NA	NA
BAB34740.2|1388129_1389749_-	membrane-associated metal-dependent hydrolase	NA	NA	NA	NA	NA
BAB34742.1|1389973_1390249_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34744.2|1390629_1391328_+	urease accessory protein	NA	NA	NA	NA	NA
BAB34745.1|1391418_1391721_+	urease subunit gamma	NA	NA	NA	NA	NA
BAB34746.1|1391729_1392050_+	urease subunit beta	NA	NA	NA	NA	NA
BAB34747.2|1392042_1393746_+	urease subunit alpha	NA	NA	NA	NA	NA
BAB34748.1|1393755_1394220_+	urease accessory protein	NA	NA	NA	NA	NA
BAB34749.1|1394220_1394895_+	urease accessory protein	NA	NA	NA	NA	NA
BAB34750.1|1394906_1395524_+	urease accessory protein	NA	NA	NA	NA	NA
BAB34753.1|1396735_1396999_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
BAB34756.1|1398312_1398984_-	membrane protein	NA	NA	NA	NA	NA
BAB34759.2|1400516_1401002_-	hypothetical protein	NA	A0A218MNE7	uncultured_virus	42.0	9.5e-31
BAB34760.1|1401321_1401747_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
BAB34761.1|1401743_1402094_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
BAB34762.1|1402124_1403738_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
BAB34763.2|1403741_1404599_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	30.4	6.6e-27
BAB34764.2|1404680_1405022_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34765.1|1405008_1405338_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34766.1|1405598_1406066_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
BAB34767.1|1406083_1407292_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34768.1|1407302_1408259_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34769.2|1408258_1409338_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
BAB34771.1|1409339_1410113_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34772.1|1410105_1411248_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
BAB34773.1|1411257_1412316_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34774.1|1412638_1413220_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
BAB34775.2|1413219_1414377_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
BAB34776.1|1414399_1414855_+	tellurium resistance protein TerB	NA	NA	NA	NA	NA
BAB34777.1|1414877_1415918_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
BAB34778.1|1415966_1416545_+	tellurium resistance protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
BAB34779.1|1416613_1417189_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
BAB34781.1|1417610_1417919_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
BAB34783.1|1418510_1420601_-	Iha adhesin	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
BAB34785.2|1422053_1422272_+	hypothetical protein	NA	NA	NA	NA	NA
BBE29407.1|1422904_1423240_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34787.1|1424020_1424215_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34788.2|1424266_1424446_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34789.1|1424534_1424807_+	hypothetical protein	NA	NA	NA	NA	NA
BBE29408.1|1425371_1425569_+	regulatory protein	NA	NA	NA	NA	NA
BAB34793.1|1426298_1427423_+	glucosyl-transferase	NA	NA	NA	NA	NA
BAB34795.2|1427841_1428135_-|transposase	IS1 family transposase InsB	transposase	U5P0U6	Shigella_phage	92.8	8.3e-46
BAB34796.1|1428263_1428539_-|transposase	IS1 family transposase InsA	transposase	Q71TE9	Escherichia_phage	91.2	2.8e-43
BAB34797.1|1428776_1429235_-	membrane protein	NA	NA	NA	NA	NA
BAB34799.1|1429692_1430202_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34800.1|1430290_1430914_+	DNA-binding protein	NA	NA	NA	NA	NA
BAB34801.1|1431009_1431243_+	hypothetical protein	NA	NA	NA	NA	NA
BBE29409.1|1431295_1431487_-	hypothetical protein	NA	NA	NA	NA	NA
BAB34803.1|1432080_1432968_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C035	Escherichia_phage	99.7	6.2e-169
BAB34804.1|1432967_1433294_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	4.1e-54
BAB34805.2|1433474_1434521_+	HecB-like protein	NA	NA	NA	NA	NA
BAB34809.1|1437942_1439175_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	5.0e-60
BAB34810.1|1439159_1439798_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
BAB34811.1|1439876_1440146_+	transcriptional regulator PchD	NA	NA	NA	NA	NA
BAB34812.1|1440166_1440811_+	hypothetical protein	NA	NA	NA	NA	NA
BBE29410.1|1441126_1441627_+	glycolate transporter	NA	Q9EYF6	Enterobacteria_phage	96.4	4.6e-28
BAB34816.1|1441810_1442236_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
>prophage 6
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	1538785	1664738	5498578	holin,terminase,head,lysis,capsid,portal,integrase,transposase,tRNA,protease,tail	Enterobacteria_phage(33.33%)	159	1529445:1529460	1668713:1668728
1529445:1529460	attL	CGACGTTATATTTTTT	NA	NA	NA	NA
BAB34921.1|1538785_1539607_+	deacetylase of acs and cheY chemotaxis regulator	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
BAB34922.1|1539762_1540809_-	spermidine/putrescine ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BAB34923.1|1540805_1541600_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
BAB34924.1|1541766_1542885_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
BAB34925.1|1542853_1543123_-	phage excisionase	NA	NA	NA	NA	NA
BAB34926.2|1543184_1543529_-	exodeoxyribonuclease VIII	NA	K7PLW7	Enterobacteria_phage	59.6	3.2e-33
BAB34927.2|1543706_1544222_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34928.1|1544336_1544567_-	hypothetical protein	NA	M4QQ57	Salicola_phage	55.3	1.6e-07
BAB34929.1|1544804_1545281_-	phage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
BAB34930.1|1545405_1545729_+	antirepressor	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
BAB34931.1|1545712_1546138_+	transcriptional regulator	NA	NA	NA	NA	NA
BAB34932.1|1546206_1547244_+	phage replication protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
BAB34933.2|1547275_1547698_+	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
BAB34934.1|1547731_1548448_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
BAB34935.1|1548444_1548762_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
BAB34936.1|1548758_1549061_+	hypothetical protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
BAB34937.1|1549050_1549368_+	hypothetical protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
BAB34938.1|1549321_1549639_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
BAB34939.1|1549625_1550063_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
BAB34940.1|1550064_1550256_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
BAB34941.1|1550258_1550846_+	putative phage protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
BBE29411.1|1550961_1551066_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34943.1|1551254_1551467_+	regulatory protein MokC for HokC	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
BAB34945.1|1551914_1552964_+	hypothetical protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
BAB34946.1|1552976_1553351_+	phage endonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
BAB34947.1|1553347_1554169_+	phage antitermination protein Q	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
BBE29412.1|1554622_1554769_+	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	95.8	6.8e-17
BBE29413.1|1554765_1554933_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
BAB34950.1|1555247_1557185_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
BAB34951.1|1557332_1557515_+	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
BAB34952.1|1557552_1557822_+	hypothetical protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
BAB34953.1|1557897_1558113_+|lysis	S lysis protein	lysis	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
BAB34954.1|1558117_1558462_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
BAB34955.1|1558512_1559046_+	phage endolysin	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
BAB34956.1|1559316_1559886_+	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BBE29414.1|1559885_1560032_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BAB34957.1|1560039_1560507_+	phage murein endopeptidase	NA	A0A0H4IT10	Shigella_phage	95.5	1.6e-75
BAB34958.1|1560259_1560466_+	lipoprotein precursor	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
BAB34959.1|1560530_1560755_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34961.1|1561111_1561252_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34962.2|1561474_1561564_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34963.1|1561608_1561974_+	DNase	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
BAB34964.1|1562263_1562827_+|terminase	phage terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
BAB34965.1|1562823_1564485_+|terminase	phage terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
BAB34966.1|1564548_1566486_+|head,protease	phage prohead protease	head,protease	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
BBE29415.1|1566530_1566752_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
BAB34967.1|1566697_1569199_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
BAB34968.1|1569278_1569605_+	phage DNA packaging protein	NA	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
BAB34969.1|1569614_1569965_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
BAB34970.1|1569961_1570408_+|tail	phage minor tail protein	tail	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
BAB34971.1|1570404_1570749_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BAB34972.1|1570807_1571524_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.8e-127
BAB34973.1|1571529_1571904_+|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
BAB34974.2|1571999_1572209_+|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BAB34975.2|1572261_1575504_+|tail	phage tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
BAB34977.1|1575496_1575838_+|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
BAB34978.1|1575837_1576536_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
BAB34979.1|1576552_1576807_-	transcriptional regulator	NA	NA	NA	NA	NA
BAB34980.1|1577329_1578208_+	phage antirepressor protein	NA	I6R977	Salmonella_phage	77.2	2.5e-93
BAB34981.1|1578261_1578999_+|tail	phage tail assembly protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
BAB34982.2|1578995_1579181_+|tail	phage tail assembly protein	tail	H6WZM5	Escherichia_phage	72.7	1.3e-09
BBE29416.1|1579193_1579283_+	hypothetical protein	NA	NA	NA	NA	NA
BAB34983.1|1579302_1581651_+	T3SS effector-like protein EspX	NA	NA	NA	NA	NA
BAB34984.1|1582241_1585643_+	T3SS secreted effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
BAB34986.1|1585811_1586261_+	outer membrane pore protein	NA	NA	NA	NA	NA
BAB34987.1|1586185_1587091_-|transposase	IS2 transposase	transposase	Q9ZXG3	Shigella_phage	98.7	6.3e-177
BAB34988.1|1587252_1587414_-|transposase	IS2 transposase	transposase	Q76S41	Shigella_phage	100.0	3.5e-22
BAB34990.1|1587951_1588227_-	T3SS secreted effector EspO	NA	NA	NA	NA	NA
BAB34991.1|1588287_1589649_-	T3SS secreted effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
BAB34993.1|1590012_1590876_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
BAB34994.1|1590859_1591996_-	spermidine/putrescine ABC transporter ATPase	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
BAB34995.1|1592245_1593472_+	peptidase T	NA	NA	NA	NA	NA
BAB34996.2|1593520_1594642_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
BAB34997.1|1594890_1596120_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
BAB34999.1|1596730_1597474_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35000.1|1597499_1597697_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35001.1|1597689_1597875_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35002.1|1597874_1598066_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
BAB35003.1|1598055_1598298_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35004.1|1598303_1598603_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35005.2|1598599_1600732_+	DNA primerse	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
BAB35009.1|1601102_1601354_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35010.1|1601350_1601761_+	single stranded DNA-binding protein	NA	NA	NA	NA	NA
BAB35011.1|1601771_1602044_+	transcriptional regulator PchE	NA	NA	NA	NA	NA
BAB35012.1|1602168_1602393_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35013.1|1602685_1603843_+|head	major head protein	head	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
BAB35014.2|1603882_1604455_+|head,protease	phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
BAB35015.2|1604492_1605668_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	2.4e-184
BAB35016.1|1605664_1606003_+|head,tail	phage head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
BAB35017.1|1605999_1606296_+	phage DNA packaging protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
BAB35018.1|1606295_1606736_+|holin	holin protein	holin	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
BAB35020.1|1607025_1607382_+|terminase	phage terminase small subunit	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
BAB35021.1|1607365_1609027_+|terminase	phage terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	9.8e-277
BAB35022.1|1609040_1609322_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35024.1|1610178_1611639_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
BAB35025.1|1611638_1612310_-	two-component regulatory system response regulator PhoP	NA	NA	NA	NA	NA
BAB35026.1|1612478_1613849_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
BAB35027.1|1613852_1614494_-	lysogenization regulator	NA	NA	NA	NA	NA
BAB35028.2|1614529_1615636_-|tRNA	tRNA(Gln,Lys,Glu) U34 2-thiouridylase	tRNA	NA	NA	NA	NA
BAB35029.1|1615689_1616151_-	bifunctional thiamine pyrimidine pyrophosphate hydrolase and thiamine pyrophosphate hydrolase	NA	NA	NA	NA	NA
BAB35030.1|1616160_1616814_-	23S rRNA pseudouridine synthase	NA	NA	NA	NA	NA
BAB35031.1|1616985_1618236_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
BAB35032.1|1618349_1619492_-|integrase	integrase	integrase	O21940	Phage_21	100.0	8.1e-206
BAB35033.1|1619481_1619718_-	phage excisionase	NA	NA	NA	NA	NA
BAB35034.1|1619821_1620646_+	phage replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
BAB35035.1|1620642_1621344_+	phage replication protein	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
BAB35036.1|1621340_1621643_+	phage exclusion protein	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
BAB35037.1|1621710_1622043_+	multidrug resistance protein	NA	NA	NA	NA	NA
BAB35038.1|1622287_1623814_+	phage recombinase	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
BAB35039.1|1624315_1624771_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
BAB35040.1|1624770_1624941_+	putative phage protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
BAB35041.1|1624933_1625224_+	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
BAB35042.1|1625220_1625583_+	phage endonuclease	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
BBE29417.1|1625579_1625720_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
BAB35043.1|1625716_1626406_+	phage antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
BAB35044.2|1626727_1627033_+|holin	phage holin protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
BAB35045.1|1627019_1627496_+	phage endolysin	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
BAB35046.1|1627492_1627954_+	phage murein endopeptidase	NA	A0A0K2FJD0	Enterobacteria_phage	97.4	2.7e-75
BAB35047.1|1627712_1627895_+	lipoprotein precursor	NA	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
BAB35048.1|1627985_1628279_-	Bor protein precursor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
BAB35049.2|1628570_1628981_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
BAB35050.1|1629266_1629473_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
BAB35052.1|1630220_1630766_+|terminase	phage terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
BAB35053.1|1630740_1632666_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
BAB35054.1|1632662_1632869_+|head,tail	phage head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
BAB35055.1|1632865_1634467_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
BAB35056.1|1634447_1635767_+|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
BAB35057.1|1635776_1636109_+|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
BAB35058.1|1636164_1637190_+|capsid	phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
BAB35059.1|1637231_1637630_+	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
BAB35060.1|1637641_1637995_+|head,tail	phage head-tail adaptor protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
BAB35061.1|1638006_1638585_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
BAB35062.1|1638581_1638977_+|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
BAB35063.1|1638984_1639725_+|tail	phage major tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
BAB35064.1|1639740_1640163_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
BAB35065.1|1640144_1640579_+|tail	phage minor tail protein	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
BAB35066.1|1640571_1643121_+|tail	phage tail length tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
BAB35067.1|1643117_1643447_+|tail	phage minor tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
BAB35068.1|1643446_1644145_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
BAB35069.1|1644150_1644894_+|tail	phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
BAB35070.2|1644890_1645463_+|tail	phage tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.9	1.1e-83
BAB35071.1|1645523_1648922_+	phage host specificity protein	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
BAB35072.1|1648988_1649588_+	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
BAB35073.1|1649652_1652568_+|tail	phage side tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
BAB35074.1|1652567_1653149_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
BAB35075.1|1653268_1654159_-	catalase	NA	NA	NA	NA	NA
BAB35076.1|1654177_1654684_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35077.1|1654720_1655221_-	putative phage protein	NA	NA	NA	NA	NA
BAB35078.1|1655299_1655482_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35079.2|1655979_1656648_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35080.1|1656704_1656953_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
BAB35081.1|1657028_1657409_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BAB35082.1|1657405_1657753_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BAB35083.1|1657802_1659341_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BAB35085.1|1659643_1661128_-	hydrolase	NA	NA	NA	NA	NA
BAB35086.1|1661314_1662268_-|protease	outer membrane protease VII	protease	NA	NA	NA	NA
BAB35087.1|1662766_1663351_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35088.1|1663524_1663851_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BAB35089.2|1663850_1664738_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
1668713:1668728	attR	CGACGTTATATTTTTT	NA	NA	NA	NA
>prophage 7
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	1757685	1825258	5498578	terminase,head,lysis,portal,integrase,transposase,tRNA,protease,tail	Stx2-converting_phage(43.14%)	75	1757522:1757549	1815697:1815724
1757522:1757549	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
BAB35180.1|1757685_1758816_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
BAB35181.1|1758793_1759042_-	excisionase	NA	NA	NA	NA	NA
BAB35182.1|1759106_1761578_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
BAB35183.1|1761670_1761862_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35184.1|1761858_1762047_-	cell division inhibition protein	NA	NA	NA	NA	NA
BAB35185.1|1762520_1762754_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35186.1|1762731_1763139_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
BAB35187.1|1763161_1763380_-	hypothetical protein	NA	NA	NA	NA	NA
BBE29421.1|1763452_1763752_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35188.1|1764015_1764423_-	phage repressor protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
BAB35189.1|1764499_1764727_+	phage antirepressor	NA	NA	NA	NA	NA
BAB35190.1|1764710_1765262_+	phage regulatory protein	NA	NA	NA	NA	NA
BAB35191.1|1765233_1766274_+	phage replication protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
BAB35192.2|1766305_1766728_+	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
BBE29422.1|1766914_1767496_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
BBE29423.1|1767492_1767657_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35195.1|1768355_1769114_+	porcine attaching-effacing associated protein Paa/adherence factor AdfO	NA	NA	NA	NA	NA
BAB35196.1|1769392_1769605_+	phage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
BAB35197.1|1769825_1770083_+	putative phage protein	NA	NA	NA	NA	NA
BAB35198.1|1770152_1770431_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
BAB35199.1|1770432_1771479_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
BAB35200.1|1771491_1771851_+	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
BAB35201.1|1771859_1772390_+	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
BAB35202.2|1772631_1772829_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
BAB35203.1|1772979_1774038_+	DNA methylase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
BAB35204.1|1774834_1776688_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
BAB35205.1|1776837_1777053_+|lysis	S lysis protein	lysis	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
BAB35206.1|1777057_1777402_+	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
BAB35207.1|1777452_1777986_+	phage endolysin	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
BAB35208.1|1778256_1778826_+	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BBE29424.1|1778825_1778972_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BAB35209.1|1778979_1779447_+	phage endopeptidase	NA	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
BAB35210.1|1779199_1779385_+	lipoprotein precursor	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
BAB35211.1|1779809_1780037_-	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
BAB35212.1|1780078_1780444_+	DNase	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
BAB35214.1|1780733_1781297_+|terminase	phage terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
BAB35215.1|1781293_1782955_+|terminase	phage terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
BAB35216.1|1783018_1784956_+|head,protease	phage prohead protease	head,protease	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
BAB35217.2|1785000_1785222_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
BAB35218.1|1785167_1787747_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
BAB35219.1|1787749_1788076_+	phage DNA packaging protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
BAB35220.1|1788085_1788436_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BAB35221.1|1788432_1788879_+|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BAB35222.1|1788875_1789220_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BAB35223.2|1789278_1789995_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	3.1e-126
BAB35224.1|1790000_1790375_+|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
BAB35225.2|1790470_1790680_+|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BAB35226.1|1790732_1793813_+|tail	phage tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
BAB35227.1|1793805_1794147_+|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
BAB35228.1|1794146_1794584_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
BAB35229.1|1794771_1798248_+	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
BAB35230.1|1798315_1798915_+	outer membrane precursor Lom	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
BAB35231.1|1799066_1800380_+|tail	phage tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
BAB35232.1|1800381_1800651_+	hypothetical protein	NA	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
BAB35235.1|1801677_1803003_-	T3SS secreted effector NleA/EspI	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
BAB35237.1|1804829_1805741_+	T3SS secreted effector NleH	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
BAB35238.1|1805806_1806376_+	T3SS secreted effector NleF	NA	NA	NA	NA	NA
BAB35239.1|1806422_1806680_-|transposase	transposase	transposase	NA	NA	NA	NA
BAB35241.1|1807341_1808880_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BAB35242.1|1808929_1809277_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BAB35243.1|1809273_1809654_-	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BAB35244.1|1809993_1810272_-	T3SS secreted effector EspO	NA	NA	NA	NA	NA
BAB35246.1|1810699_1810846_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35247.1|1810982_1811630_-	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
BAB35248.1|1811813_1812404_+	T3SS secreted effector EspM	NA	NA	NA	NA	NA
BAB35252.1|1815874_1816381_-	hypothetical protein	NA	NA	NA	NA	NA
1815697:1815724	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
BAB35253.1|1816426_1816927_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35254.2|1817012_1817192_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35255.1|1817572_1818379_-	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
BAB35256.1|1818378_1819572_-	tryptophan synthase beta chain	NA	NA	NA	NA	NA
BAB35257.2|1819583_1820942_-	indole-3-glycerolphosphate synthetase and N-(5-phosphoribosyl)anthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
BAB35258.1|1820945_1822541_-	anthranilate synthase component II	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
BAB35259.1|1822540_1824103_-	component I of anthranilate synthase	NA	NA	NA	NA	NA
BAB35260.1|1824194_1824239_-	trp operon leader peptide	NA	NA	NA	NA	NA
BAB35261.1|1824376_1825258_+|tRNA	S-adenosylmethionine tRNA ribosyltransferase	tRNA	NA	NA	NA	NA
>prophage 8
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	1909345	1973279	5498578	holin,terminase,head,portal,transposase,integrase,tRNA,protease,tail	Escherichia_phage(36.92%)	75	1899225:1899240	1953082:1953097
1899225:1899240	attL	GAATTTGCCTGAATAT	NA	NA	NA	NA
BAB35341.2|1909345_1910233_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BAB35342.1|1910232_1910559_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BAB35344.1|1911418_1912864_-	aminobenzoyl-glutamate utilization protein B	NA	NA	NA	NA	NA
BAB35345.2|1912863_1914174_-	aminobenzoyl-glutamate utilization protein A	NA	NA	NA	NA	NA
BAB35346.1|1914349_1915258_+	transcriptional regulator of abgABT operon	NA	NA	NA	NA	NA
BAB35347.1|1915587_1916151_+	DNA endonuclease	NA	NA	NA	NA	NA
BAB35348.2|1916171_1917404_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
BAB35349.1|1917658_1918642_+	Zn(II) transporter	NA	NA	NA	NA	NA
BAB35350.1|1919119_1920493_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
BAB35351.1|1920621_1921557_-|tRNA	tRNA s(2)C32 thioltransferase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
BAB35352.1|1921608_1922844_-|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
BAB35353.2|1922845_1923061_-	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
BAB35354.1|1923160_1923349_-	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
BAB35356.1|1923591_1924401_-	recombination and repair protein	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
BAB35357.1|1924393_1926994_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
BAB35358.1|1927095_1927371_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
BBE29427.1|1927445_1927616_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
BAB35359.2|1927615_1927837_-	phage cell division inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
BAB35360.1|1928155_1928767_+	phage superinfection exclusion protein	NA	NA	NA	NA	NA
BAB35361.1|1928763_1928919_-	hypothetical protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
BAB35363.2|1928929_1929064_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35364.2|1929351_1929771_-	phage repressor protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
BAB35365.1|1929850_1930105_+	phage antirepressor Cro	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
BAB35366.1|1930101_1930524_+	phage regulatory protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
BAB35367.1|1930601_1931390_+	phage replication protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
BAB35368.1|1931396_1932143_+	phage replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
BAB35369.2|1932165_1932927_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
BAB35371.1|1932942_1933365_+	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
BAB35372.1|1933470_1933683_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
BAB35373.1|1933934_1934198_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
BAB35374.1|1934208_1934370_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
BAB35376.1|1935125_1936277_+	DNA methylase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
BAB35377.1|1936244_1937234_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35378.1|1937233_1938625_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35379.1|1939124_1939724_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
BAB35380.1|1939723_1940014_+	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
BAB35381.1|1940010_1940565_+	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
BAB35382.1|1941126_1941558_+	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
BAB35383.2|1941370_1941889_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35384.1|1942132_1943986_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
BAB35385.1|1944135_1944351_+|holin	phage holin protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
BAB35386.1|1944355_1944700_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
BAB35387.1|1944750_1945284_+	phage endolysin	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
BAB35388.1|1945554_1946124_+	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BAB35389.2|1946123_1946270_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BBE29428.1|1946277_1946745_+	phage endopeptidase	NA	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
BAB35390.1|1947107_1947335_-	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
BAB35391.1|1947376_1947742_+	DNase	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
BAB35393.1|1948031_1948595_+|terminase	phage terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
BAB35394.1|1948591_1950253_+|terminase	phage terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
BAB35395.1|1950316_1952254_+|head,protease	phage prohead protease	head,protease	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
BBE29429.1|1952298_1952520_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
BAB35397.1|1952465_1953830_+|portal	phage portal protein	portal	A0A0P0ZCX8	Stx2-converting_phage	98.5	6.4e-258
1953082:1953097	attR	ATATTCAGGCAAATTC	NA	NA	NA	NA
BAB35398.1|1953826_1955050_+|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	98.0	9.9e-101
BAB35399.1|1955046_1955373_+	phage DNA packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
BAB35400.1|1955382_1955733_+|head,tail	phage head-tail adaptor	head,tail	H6WZL5	Escherichia_phage	100.0	2.0e-59
BAB35401.1|1955729_1956176_+|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BAB35402.1|1956172_1956517_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
BAB35403.1|1956585_1957302_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
BAB35404.1|1957307_1957682_+|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
BAB35405.2|1957777_1957987_+|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BAB35406.1|1958038_1961119_+|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
BAB35407.1|1961111_1961453_+|tail	phage minor tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
BAB35408.1|1961452_1962151_+|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
BAB35409.1|1962161_1962905_+|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
BAB35410.2|1962901_1963483_+|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	89.6	3.3e-86
BAB35412.1|1963673_1964201_-	copper/zinc-superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
BAB35413.1|1964334_1967832_+	phage host specificity protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
BAB35414.1|1967902_1968502_+	outer membrane precursor Lom	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
BAB35415.2|1968566_1969880_+|tail	phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
BAB35416.2|1969881_1970151_+	hypothetical protein	NA	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
BAB35417.1|1970263_1970839_+	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
BAB35418.1|1970911_1971541_+	T3SS secreted effector NleG	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
BAB35419.1|1971622_1972264_+	T3SS secreted effector NleG	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
BAB35420.2|1972844_1973279_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 9
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	2155246	2253973	5498578	holin,terminase,head,capsid,portal,transposase,protease,tail	Enterobacteria_phage(29.73%)	127	NA	NA
BAB35573.1|2155246_2155450_+	selenoprotein	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
BAB35574.1|2155485_2156946_-	NAD-dependent D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
BAB35576.2|2158377_2158692_+	DNA damage-inducible protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
BAB35577.1|2158853_2159495_-	T3SS secreted effector NleG	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
BAB35578.1|2159576_2160206_-	T3SS secreted effector NleG	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
BAB35579.1|2160278_2160854_-	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
BAB35580.1|2160967_2161237_-	hypothetical protein	NA	H6WZN0	Escherichia_phage	98.9	6.4e-45
BAB35582.2|2161650_2162460_-|tail	phage tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	2.1e-59
BAB35583.1|2162524_2163124_-	outer membrane precursor Lom	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
BAB35584.1|2163191_2166671_-	phage host specificity protein	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
BAB35585.2|2166911_2167490_-|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.4e-99
BAB35586.2|2167486_2168230_-|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
BAB35587.1|2168240_2168939_-|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
BAB35588.1|2168938_2169268_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BAB35589.1|2169264_2171877_-|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
BAB35590.1|2171857_2172271_-|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
BAB35591.1|2172297_2172720_-|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
BAB35592.1|2172733_2173486_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BAB35593.1|2173493_2173889_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
BAB35594.1|2173885_2174419_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
BAB35595.1|2174433_2174787_-|head,tail	phage head-tail adaptor protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
BAB35596.1|2174798_2175197_-	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
BAB35597.1|2175238_2176264_-|capsid	phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
BAB35598.1|2176319_2176652_-|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
BAB35599.1|2176661_2177981_-|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
BAB35600.1|2177961_2179563_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
BAB35601.1|2179559_2179766_-|head,tail	phage head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
BAB35602.1|2179762_2181688_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
BAB35603.1|2181662_2182208_-	phage DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
BAB35605.1|2182900_2183215_-	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BAB35607.2|2183678_2184137_-	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	83.4	4.4e-62
BAB35606.2|2183740_2183926_-	lipoprotein precursor	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
BBE29434.1|2184148_2184295_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
BAB35608.2|2184294_2184864_-	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BAB35609.2|2185134_2185668_-	phage endolysin	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
BAB35610.1|2185718_2186063_-	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
BAB35611.1|2186067_2186274_-|holin	holin protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
BAB35612.2|2186721_2188572_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
BBE29435.1|2188885_2189053_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
BAB35613.1|2189049_2189481_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
BAB35614.1|2189931_2190519_-	phage regulatory protein	NA	NA	NA	NA	NA
BAB35615.1|2190780_2190978_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
BAB35616.1|2191202_2191757_-	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
BAB35617.1|2191819_2192125_-	phage endonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
BAB35618.2|2192137_2193187_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
BAB35619.1|2193188_2193461_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
BAB35620.1|2193582_2193927_-	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
BAB35621.1|2194046_2194259_-	regulatory protein MokC for HokC	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
BAB35622.1|2194492_2195050_-	putative phage protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
BAB35624.1|2195397_2195709_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
BAB35625.1|2195701_2195929_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
BAB35626.1|2195925_2196207_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
BAB35627.2|2196239_2196956_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
BAB35628.2|2196989_2197451_-	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
BAB35629.1|2197443_2198487_-	replication protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
BAB35630.1|2198555_2198981_-	transcriptional regulator	NA	NA	NA	NA	NA
BAB35631.1|2198964_2199207_-	phage antirepressor protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
BAB35632.2|2199598_2199937_+	phage repressor protein	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
BAB35633.1|2200148_2200382_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	7.8e-07
BAB35634.1|2200393_2201032_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
BAB35635.1|2201032_2201242_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35637.1|2201806_2201995_+	cell division inhibition protein	NA	NA	NA	NA	NA
BAB35638.1|2201991_2202180_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35641.1|2204155_2204410_+	DNA damage-inducible protein	NA	H6WZN4	Escherichia_phage	82.5	3.4e-11
BAB35642.2|2204412_2205300_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BAB35643.1|2205299_2205626_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BAB35644.1|2205832_2206702_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.2e-47
BAB35645.1|2206745_2207126_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BAB35646.1|2207122_2207470_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BAB35647.1|2207519_2209058_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BAB35648.1|2209068_2209491_-|transposase	transposase	transposase	F6MIM4	Haemophilus_phage	69.8	1.9e-11
BAB35653.1|2211690_2211960_-	hypothetical protein	NA	H6WZN0	Escherichia_phage	98.9	6.4e-45
BAB35654.1|2211961_2213185_-|tail	phage tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
BAB35655.1|2213249_2213849_-	outer membrane precursor Lom	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
BAB35656.1|2213916_2214132_-	phage host specificity protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
BAB35657.2|2214134_2216264_-	phage host specificity protein	NA	Q9EYE7	Enterobacteria_phage	98.6	0.0e+00
BAB35658.1|2216215_2217391_-	phage host specificity protein	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
BAB35659.2|2217732_2218314_-|tail	phage tail assembly protein	tail	H6WZM5	Escherichia_phage	96.9	2.2e-90
BAB35660.2|2218310_2219054_-|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
BAB35661.1|2219064_2219763_-|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
BAB35662.1|2219762_2220104_-|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
BAB35663.1|2220096_2223339_-|tail	phage tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
BAB35664.2|2223386_2223596_-|tail	phage minor tail protein	tail	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
BAB35665.1|2223691_2224066_-|tail	phage tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
BAB35666.1|2224080_2224797_-|tail	phage major tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
BAB35667.1|2224862_2225207_-|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BAB35668.1|2225203_2225650_-|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BAB35669.1|2225646_2225997_-|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BAB35670.1|2226006_2226333_-	phage DNA packaging protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
BAB35671.1|2226335_2228915_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
BBE29436.1|2228860_2229082_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
BAB35673.1|2229126_2231064_-|head,protease	phage prohead protease	head,protease	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
BAB35674.1|2231127_2232789_-|terminase	phage terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
BAB35675.1|2232785_2233349_-|terminase	phage terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
BAB35677.1|2233638_2234004_-	DNase	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
BAB35678.1|2234045_2234273_+	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
BAB35680.2|2234635_2235103_-	phage endopeptidase	NA	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
BAB35679.2|2234697_2234883_-	lipoprotein precursor	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
BBE29437.1|2235110_2235257_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BAB35681.1|2235256_2235826_-	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BAB35682.1|2236096_2236630_-	phage endolysin	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
BAB35683.1|2236680_2237025_-	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
BAB35684.1|2237029_2237236_-|holin	holin protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
BAB35685.1|2237684_2239535_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
BBE29438.1|2239849_2240017_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	72.5	3.2e-10
BAB35688.1|2240013_2240442_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
BAB35690.1|2241081_2241771_-	phage late gene regulator Q	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
BAB35691.1|2241767_2242127_-	phage endonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
BAB35692.1|2242139_2243189_-	hypothetical protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
BBE29439.1|2243636_2243849_-	regulatory protein MokC for HokC	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
BAB35694.1|2244037_2244142_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35695.1|2244257_2244842_-	hypothetical protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
BAB35696.1|2244898_2245294_-	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
BAB35697.1|2245309_2245978_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	61.2	1.0e-62
BAB35698.1|2246104_2246845_-	phage DNA replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
BAB35699.2|2246851_2247814_-	phage replication protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
BAB35700.1|2247836_2248262_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35701.1|2248258_2248561_-	phage antirepressor protein Cro	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
BAB35702.2|2248658_2249030_+	phage repressor protein CI	NA	NA	NA	NA	NA
BAB35703.2|2249050_2249242_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35704.1|2249243_2249522_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35705.2|2249952_2250153_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35706.2|2250245_2250464_+	hypothetical protein	NA	NA	NA	NA	NA
BBE29440.1|2250467_2250632_-	hypothetical protein	NA	NA	NA	NA	NA
BAB35707.1|2251032_2251221_+	cell division inhibition protein	NA	NA	NA	NA	NA
BAB35708.1|2251217_2251409_+	hypothetical protein	NA	NA	NA	NA	NA
BAB35709.1|2251501_2253973_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
>prophage 10
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	2555508	2613145	5498578	integrase,tRNA,transposase,tail	Enterobacteria_phage(59.38%)	64	2555352:2555367	2613326:2613341
2555352:2555367	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
BAB36004.1|2555508_2556480_+|tRNA	tRNA (cmo5U34)-carboxymethyltransferase	tRNA	NA	NA	NA	NA
BAB36005.2|2556644_2559074_-	biotin sulfoxide reductase	NA	NA	NA	NA	NA
BAB36006.1|2559098_2560199_-	TMAO reductase III cytochrome c-type subunit	NA	NA	NA	NA	NA
BAB36007.2|2560586_2561333_-	copper homeostasis protein	NA	NA	NA	NA	NA
BAB36008.2|2561346_2561913_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36009.1|2562128_2563862_+|tRNA	arginyl-tRNA synthetase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
BAB36010.1|2564038_2564527_+	hypothetical protein	NA	NA	NA	NA	NA
BAB36011.2|2564646_2565042_-	flagellar protein FlhE	NA	NA	NA	NA	NA
BAB36012.1|2565038_2567117_-	flagellar export pore protein	NA	NA	NA	NA	NA
BAB36013.1|2567109_2568258_-	flagellin export apparatus substrate specificity protein	NA	NA	NA	NA	NA
BAB36014.1|2568459_2569104_-	chemotaxis protein CheZ	NA	NA	NA	NA	NA
BAB36015.1|2569114_2569504_-	chemotaxis regulator transmitting signal to flagellar motor component	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
BAB36016.1|2569518_2570568_-	chemotaxis-specific methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
BAB36017.1|2570570_2571431_-	chemotaxis protein methyltransferase CheR	NA	NA	NA	NA	NA
BAB36018.1|2571449_2573051_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
BAB36019.1|2573096_2574758_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
BAB36020.1|2574900_2575404_-	purine-binding chemotaxis protein	NA	NA	NA	NA	NA
BAB36021.1|2575424_2577389_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
BAB36022.1|2577393_2578320_-	chemotaxis protein MotB	NA	NA	NA	NA	NA
BAB36023.1|2578316_2579204_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
BAB36024.1|2579330_2579909_-	flagellar class II regulon transcriptional activator	NA	NA	NA	NA	NA
BAB36025.2|2579911_2580262_-	flagellar class II regulon transcriptional activator	NA	NA	NA	NA	NA
BAB36026.1|2581041_2581470_+	universal stress protein	NA	NA	NA	NA	NA
BAB36027.1|2581476_2582901_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
BAB36028.1|2582875_2583676_-	trehalose-6-phosphate phosphatase	NA	NA	NA	NA	NA
BAB36031.1|2584843_2586358_-	L-arabinose ABC transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
BAB36032.1|2586427_2587417_-	L-arabinose ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BAB36033.1|2588213_2588717_+	ferritin B	NA	NA	NA	NA	NA
BBE29443.1|2588796_2589048_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36035.1|2589510_2589834_+	lipoprotein	NA	NA	NA	NA	NA
BAB36036.1|2590004_2590502_+	ferritin iron storage protein	NA	NA	NA	NA	NA
BAB36037.1|2590538_2590778_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36038.1|2590969_2592181_+	tyrosine transporter	NA	NA	NA	NA	NA
BAB36039.1|2592242_2592908_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36040.1|2593264_2594266_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
BAB36041.1|2594271_2594619_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36042.1|2594648_2595299_-	membrane protein	NA	NA	NA	NA	NA
BAB36043.1|2595314_2595719_-	phage repressor protein	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
BAB36044.1|2595808_2595946_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36045.1|2596017_2596221_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
BAB36046.1|2596242_2596593_+	hypothetical protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
BAB36047.1|2596603_2596882_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
BAB36048.1|2596893_2597136_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
BBE29444.1|2597132_2597246_+	membrane protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
BAB36049.1|2597338_2597755_+	hypothetical protein	NA	NA	NA	NA	NA
BAB36050.1|2597778_2597982_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
BAB36051.1|2597978_2598245_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
BAB36052.1|2598241_2598541_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
BAB36053.1|2598552_2599170_+	antirepressor protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
BAB36054.1|2598863_2599094_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
BAB36055.1|2599166_2599532_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
BAB36056.2|2599538_2602361_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
BAB36057.1|2602437_2603397_+	plasmid partition protein	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
BAB36058.1|2603401_2603716_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
BAB36059.1|2603735_2604425_-|transposase	IS629 transposase OrfB	transposase	H6WZH1	Escherichia_phage	99.6	1.3e-126
BAB36060.2|2604424_2604751_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	98.1	6.3e-55
BBE29445.1|2604921_2605338_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
BAB36061.2|2605381_2605954_-	hypothetical protein	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
BAB36062.1|2606110_2606599_-|tail	phage tail assembly protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
BAB36066.1|2609565_2609931_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
BAB36067.1|2609985_2610498_-|tail	phage tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
BAB36068.1|2610497_2611682_-|tail	phage tail sheath protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
BAB36069.1|2611839_2612163_+|tail	phage tail protein	tail	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
BAB36070.1|2612113_2613145_-|transposase	IS30 transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.7e-40
2613326:2613341	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 11
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	2670826	2738044	5498578	holin,terminase,head,portal,transposase,integrase,protease,tail	Escherichia_phage(34.69%)	70	2686623:2686638	2743703:2743718
BAB36139.1|2670826_2671096_-	hypothetical protein	NA	H6WZN0	Escherichia_phage	98.9	1.4e-44
BAB36140.1|2671097_2672411_-|tail	phage tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
BAB36141.1|2672475_2673075_-	outer membrane precursor Lom	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
BAB36142.2|2673142_2675494_-	phage host specificity protein	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
BAB36143.1|2675445_2676621_-	phage host specificity protein	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
BAB36144.2|2676861_2677440_-|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.4e-99
BAB36145.2|2677436_2678180_-|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
BAB36146.1|2678190_2678889_-|tail	phage minor tail protein	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
BAB36147.1|2678888_2679218_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BAB36148.1|2679214_2679979_-|tail	phage tail length tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.2	3.5e-136
BAB36149.1|2679930_2681793_-|tail	phage tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	1.4e-268
BAB36150.2|2681773_2682187_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
BAB36151.1|2682213_2682645_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
BAB36152.2|2682658_2683288_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	97.6	1.8e-106
BAB36153.1|2683380_2683647_-|head	phage head protein	head	NA	NA	NA	NA
BAB36154.1|2683704_2684052_-|head	phage head-DNA stabilization protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
BAB36155.1|2684088_2685594_-|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
BAB36156.1|2685583_2687176_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2686623:2686638	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
BAB36157.1|2687172_2687379_-|head,tail	phage head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
BAB36158.1|2687362_2689291_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
BAB36159.1|2689262_2689772_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
BAB36160.1|2690472_2690787_-	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BAB36162.2|2691251_2691719_-	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	88.3	7.2e-68
BAB36161.2|2691313_2691499_-	lipoprotein precursor	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
BBE29446.1|2691726_2691858_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
BAB36163.1|2691870_2692053_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36164.1|2692208_2692742_-	phage endolysin	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
BAB36165.1|2692792_2693137_-	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
BAB36166.1|2693141_2693348_-|holin	holin protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
BAB36167.1|2693667_2693994_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BAB36168.2|2693993_2694881_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BAB36169.1|2694962_2696813_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
BAB36171.1|2697126_2697294_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
BAB36172.1|2697290_2697719_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
BAB36173.1|2698352_2699042_-	phage late gene regulator Q	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
BAB36174.1|2699038_2699398_-	phage endonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
BAB36175.1|2699410_2700460_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
BAB36177.1|2700907_2701120_-	regulatory protein MokC for HokC	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
BAB36178.1|2701306_2701411_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36179.1|2701520_2702084_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
BAB36180.1|2702210_2702522_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
BAB36181.2|2702518_2702671_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36182.1|2702703_2703060_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
BAB36183.1|2703056_2703281_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
BAB36184.1|2703302_2704001_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
BAB36185.2|2704035_2704458_-	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
BAB36186.1|2704489_2705527_-	replication protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
BAB36187.1|2705595_2706021_-	transcriptional regulator	NA	NA	NA	NA	NA
BAB36188.1|2706017_2706245_-	phage antirepressor protein Cro	NA	NA	NA	NA	NA
BAB36189.2|2706342_2706987_+	phage repressor protein CI	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
BAB36190.1|2707261_2707414_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
BAB36191.1|2707894_2708083_+	division inhibition protein DicB	NA	NA	NA	NA	NA
BAB36192.1|2708079_2708268_+	hypothetical protein	NA	NA	NA	NA	NA
BAB36193.2|2708363_2710835_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
BAB36195.1|2710893_2711097_+	hypothetical protein	NA	NA	NA	NA	NA
BAB36196.1|2711096_2712119_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
BAB36197.2|2712354_2713152_+	anti-repressor for DgsA	NA	NA	NA	NA	NA
BAB36200.1|2721886_2722939_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36201.1|2723252_2724569_+	shikimate transporter	NA	NA	NA	NA	NA
BAB36202.1|2724670_2726125_+	AMP nucleosidase	NA	NA	NA	NA	NA
BAB36203.1|2726467_2727184_+	hypothetical protein	NA	NA	NA	NA	NA
BAB36206.1|2729570_2730521_-	ssuEADCB/tauABCD operon transcriptional activator	NA	NA	NA	NA	NA
BAB36207.1|2730622_2731540_-	nitrogen assimilation regulon transcriptional regulator	NA	NA	NA	NA	NA
BAB36208.2|2731996_2732932_-	L,D-transpeptidase linking Lpp to murein	NA	NA	NA	NA	NA
BAB36209.1|2732993_2734073_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
BAB36210.1|2734084_2734828_-	cobalamin synthase	NA	NA	NA	NA	NA
BAB36211.2|2734824_2735367_-	cobinamide kinase and cobinamide phosphate guanylyltransferase	NA	NA	NA	NA	NA
BAB36212.2|2735731_2736112_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BAB36213.1|2736108_2736456_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BAB36214.1|2736505_2738044_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
2743703:2743718	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 12
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	2870164	2946414	5498578	terminase,lysis,portal,transposase,integrase,tRNA,protease,tail	Enterobacteria_phage(68.24%)	90	2896040:2896060	2943920:2943940
BAB36343.1|2870164_2872198_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
BAB36348.1|2879155_2882785_+	hypothetical protein	NA	NA	NA	NA	NA
BAB36349.1|2882846_2883164_+	hypothetical protein	NA	NA	NA	NA	NA
BAB36350.2|2884404_2885493_+	hexameric AAA+ MoxR family ATPase	NA	NA	NA	NA	NA
BAB36353.1|2887775_2888912_+	VMA domain YehL ATPase stimulator	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
BAB36354.1|2888908_2891146_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
BAB36355.2|2890952_2891840_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BAB36356.1|2891839_2892166_-|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	100.0	3.7e-55
BAB36357.2|2892349_2892811_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
BAB36358.1|2892852_2893323_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
BAB36359.2|2893369_2894089_-	two-component regulatory system response regulator YehT	NA	NA	NA	NA	NA
BAB36360.1|2894085_2895771_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2896040:2896060	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
BAB36362.1|2896285_2896534_+	DNA-damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
BAB36363.2|2896901_2897171_-	hypothetical protein	NA	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
BAB36364.1|2897172_2898486_-|tail	phage tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
BAB36365.1|2898550_2899150_-	outer membrane precursor Lom	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
BAB36366.2|2899217_2901563_-	phage host specificity protein	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
BAB36367.1|2901514_2902690_-	phage host specificity protein	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
BAB36368.2|2902930_2903509_-|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.4e-99
BAB36369.1|2903505_2904249_-|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
BAB36370.1|2904259_2904958_-|tail	phage minor tail protein	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
BAB36371.1|2904957_2905287_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BAB36372.1|2905283_2907929_-|tail	phage tail length tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
BAB36373.1|2907972_2908281_-|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
BAB36374.1|2908307_2908730_-|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
BAB36375.1|2908743_2909496_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BAB36376.1|2909503_2909902_-|tail	phage minor tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
BAB36377.1|2909914_2910538_-|tail	phage minor tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
BAB36378.1|2910540_2910822_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
BAB36379.1|2910814_2911141_-	membrane protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
BAB36380.2|2911228_2912269_-|protease	phage protease/scaffold protein	protease	Q8VNN5	Enterobacteria_phage	99.7	5.9e-195
BAB36381.1|2912390_2912717_+|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	100.0	3.7e-55
BAB36382.2|2912716_2913604_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BAB36384.1|2914510_2916013_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
BAB36385.2|2916012_2916225_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
BAB36386.1|2916221_2918345_-|terminase	phage terminase large subunit	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
BAB36387.1|2918341_2918818_-|terminase	phage terminase small subunit	terminase	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
BAB36389.2|2919272_2919740_-	phage endopeptidase	NA	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
BAB36388.2|2919334_2919520_-	lipoprotein precursor	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
BBE29447.1|2919747_2919894_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BAB36390.1|2919893_2920463_-	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BAB36391.1|2920733_2921267_-	phage endolysin	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
BAB36392.1|2921271_2921487_-|lysis	phage lysis protein	lysis	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
BAB36393.1|2921564_2921810_-	hypothetical protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
BAB36394.1|2921850_2922030_-	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
BAB36395.1|2922167_2924114_-	hypothetical protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
BAB36396.1|2924624_2924894_-	Shiga toxin 1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
BAB36397.1|2924903_2925851_-	Shiga toxin 1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
BAB36398.2|2926357_2926840_-	antiterminator Q	NA	Q8VNP1	Enterobacteria_phage	99.4	2.4e-90
BAB36399.1|2926784_2926979_-	hypothetical protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
BAB36400.1|2926975_2927581_-	recombination endonuclease	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
BAB36401.1|2927573_2927783_-	phage protein NinF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
BAB36402.1|2927742_2928144_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
BAB36403.1|2928146_2928323_-	hypothetical protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
BAB36404.1|2928319_2928847_-	DNA methylase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
BAB36405.1|2928843_2929290_-	recombination protein	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
BAB36406.2|2929246_2929483_-	hypothetical protein	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
BBE29448.1|2929493_2929709_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
BAB36407.1|2929841_2930120_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
BAB36408.1|2930190_2930481_-	phage exclusion protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
BAB36409.1|2930477_2931179_-	phage replication protein	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
BAB36410.1|2931175_2932114_-	phage replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
BAB36411.1|2932146_2932443_-	phage regulatory protein CII	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
BAB36412.1|2932557_2932776_-	phage antirepressor protein Cro	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
BAB36413.2|2932884_2933532_+	phage repressor protein	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
BAB36414.1|2933654_2933936_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
BAB36415.1|2933942_2934494_+	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
BAB36417.1|2935006_2935279_+	phage early gene regulator N	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
BAB36418.1|2935295_2935877_-	superinfection exclusion protein	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
BAB36419.1|2936137_2936506_+	single stranded DNA-binding protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
BAB36420.1|2936578_2936743_+	phage regulatory protein CIII	NA	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
BAB36421.2|2936711_2936855_+	phage kil protein	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
BAB36423.1|2936930_2937227_+	phage host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
BAB36424.1|2937232_2938018_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
BAB36425.1|2938014_2938692_+	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
BAB36426.2|2938691_2938874_+	hypothetical protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
BAB36427.1|2938846_2939038_+	hypothetical protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
BAB36428.2|2939114_2939330_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
BAB36429.1|2939428_2939650_+	hypothetical prortein	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
BAB36430.1|2939646_2940594_+	hypothetical protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
BAB36431.1|2940595_2940772_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	98.3	3.0e-27
BAB36432.1|2941105_2941462_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
BAB36433.1|2941458_2941821_+	putative phage protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
BAB36434.1|2941908_2942151_+	hypothetical protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
BBE29449.1|2942154_2942289_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
BAB36435.1|2942307_2942562_+	phage excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
BAB36436.1|2942595_2943882_+|integrase	integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
BAB36437.1|2943956_2944604_+	transcriptional activator of csgD and csgBA	NA	Q9EYF2	Enterobacteria_phage	99.4	5.6e-95
2943920:2943940	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
BAB36438.1|2944751_2945483_-	ABC transporter permease	NA	NA	NA	NA	NA
BAB36439.1|2945487_2946414_-	transporter subunit: ATP-binding component of ABC superfamily protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 13
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	3464824	3497337	5498578	transposase,tRNA,holin,integrase	Enterobacteria_phage(31.25%)	39	3474153:3474167	3506885:3506899
BAB36893.1|3464824_3465592_-|tRNA	tRNA m(1)G37 methyltransferase	tRNA	NA	NA	NA	NA
BAB36894.2|3465622_3466171_-	ribosome maturation factor	NA	NA	NA	NA	NA
BAB36895.1|3466189_3466438_-	30S ribosomal subunit protein S16	NA	NA	NA	NA	NA
BAB36896.1|3466574_3467936_-	signal recognition particle protein	NA	NA	NA	NA	NA
BAB36897.1|3468027_3468894_+	cytochrome c assembly protein family inner membrane protein	NA	NA	NA	NA	NA
BAB36898.2|3468960_3470202_+	inner membrane protein	NA	NA	NA	NA	NA
BAB36899.1|3470256_3470850_-	co-chaperone GrpE	NA	NA	NA	NA	NA
BAB36900.1|3470972_3471851_+	NAD kinase	NA	NA	NA	NA	NA
BAB36901.1|3471936_3473598_+	recombination and repair protein RecN	NA	NA	NA	NA	NA
BAB36902.2|3473746_3474088_+	lipoprotein component of BamABCDE OM biogenesis complex	NA	NA	NA	NA	NA
BAB36903.2|3474149_3474440_-	hypothetical protein	NA	NA	NA	NA	NA
3474153:3474167	attL	TTTATTCGCTGATTT	NA	NA	NA	NA
BAB36904.2|3474429_3474879_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
BAB36905.1|3475037_3475520_+	tmRNA-binding trans-translation protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
BAB36906.1|3476365_3476614_+	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
BAB36908.1|3477115_3477706_-	T3SS secreted effector EspM	NA	NA	NA	NA	NA
BAB36909.1|3477888_3478539_+	T3SS secreted effector NleG	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
BAB36910.1|3478617_3479676_+	T3SS secreted effector EspW	NA	NA	NA	NA	NA
BAB36912.2|3480388_3480658_-	hypothetical protein	NA	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
BAB36913.1|3480875_3481202_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BAB36914.2|3481201_3482089_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BAB36916.1|3482589_3482937_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BAB36917.1|3482933_3483314_-	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BAB36918.1|3483389_3483620_-	phage endolysin	NA	B6DZ92	Enterobacteria_phage	97.3	2.8e-33
BAB36919.1|3483670_3484015_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
BAB36920.1|3484019_3484235_-|holin	holin protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
BAB36921.1|3484384_3486238_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
BAB36922.1|3486478_3486808_+	hypothetical protein	NA	NA	NA	NA	NA
BAB36923.1|3486898_3487642_-	membrane protein	NA	NA	NA	NA	NA
BAB36924.1|3487894_3488518_-	phage antitermination protein Q	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
BAB36925.1|3488514_3489180_-	serine/threonine-specific protein phosphatase 1	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
BAB36926.1|3489176_3489788_-	recombination endonuclease	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
BAB36927.1|3489762_3490329_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
BAB36928.1|3490658_3491414_+|transposase	transposase, partial	transposase	NA	NA	NA	NA
BAB36929.2|3491449_3491752_+	putative lipoprotein	NA	NA	NA	NA	NA
BAB36930.2|3491827_3493090_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36931.1|3493485_3493899_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36932.1|3493996_3494395_-	hypothetical protein	NA	NA	NA	NA	NA
BAB36933.1|3494395_3496027_-	DNA-binding protein	NA	NA	NA	NA	NA
BAB36934.1|3496023_3497337_-|integrase	integrase	integrase	NA	NA	NA	NA
3506885:3506899	attR	TTTATTCGCTGATTT	NA	NA	NA	NA
>prophage 14
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	3822650	3875030	5498578	protease,tRNA,transposase,integrase	Stx2-converting_phage(50.0%)	45	3835596:3835630	3880104:3880138
BAB37234.2|3822650_3823409_+|protease	metalloprotease	protease	NA	NA	NA	NA
BAB37235.1|3823614_3824535_-	agmatinase	NA	NA	NA	NA	NA
BAB37236.1|3824670_3825402_-	lipoprotein	NA	NA	NA	NA	NA
BAB37237.1|3825547_3827524_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
BAB37238.2|3827532_3827664_-	hypothetical protein	NA	NA	NA	NA	NA
BAB37239.1|3827799_3828015_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37240.1|3828011_3828263_-	inner membrane protein	NA	NA	NA	NA	NA
BAB37241.1|3828318_3829473_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
BAB37242.1|3829909_3831304_+	D-galactose transporter	NA	NA	NA	NA	NA
BAB37243.2|3831422_3831878_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37244.1|3831972_3832680_+	DNA-specific endonuclease I	NA	NA	NA	NA	NA
BAB37245.2|3832759_3833491_+	16S rRNA m(3)U1498 methyltransferase	NA	NA	NA	NA	NA
BAB37246.1|3833503_3834451_+	glutathione synthetase	NA	NA	NA	NA	NA
BAB37247.1|3834490_3835126_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37248.1|3835125_3835542_+	holliday junction resolvase	NA	NA	NA	NA	NA
3835596:3835630	attL	ATTGCCGGATGCGGCGTGAACGCCTTATCCGGCCT	NA	NA	NA	NA
BAB37250.2|3835732_3836713_-	twitching motility protein PilT	NA	NA	NA	NA	NA
BAB37249.2|3836730_3837435_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37251.1|3837452_3838019_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37252.2|3838015_3838306_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37253.1|3838313_3838907_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
BAB37254.1|3838899_3840036_+	oxidoreductase	NA	NA	NA	NA	NA
BAB37255.1|3840278_3841286_-	hypothetical protein	NA	NA	NA	NA	NA
BAB37256.1|3841402_3842449_-	periplasmic L-asparaginase 2	NA	NA	NA	NA	NA
BAB37257.1|3842624_3843344_-	hypothetical protein	NA	NA	NA	NA	NA
BAB37258.2|3843527_3843854_-	hypothetical protein	NA	NA	NA	NA	NA
BAB37259.1|3843853_3844573_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
BAB37260.1|3844733_3845786_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
BAB37261.1|3845813_3846089_+	oxidative damage protective factor for iron-sulfur proteins	NA	NA	NA	NA	NA
BAB37262.2|3846153_3847233_+	membrane-bound lytic murein transglycosylase C	NA	NA	NA	NA	NA
BAB37263.2|3847434_3848691_+	nucleoside transporter	NA	NA	NA	NA	NA
BAB37264.2|3848740_3850876_-	ornithine decarboxylase isozyme	NA	NA	NA	NA	NA
BAB37265.1|3851273_3851981_+	inner membrane protein	NA	NA	NA	NA	NA
BAB37266.1|3852359_3853625_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.1	3.0e-76
BAB37269.1|3854615_3855290_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	31.6	4.7e-12
BAB37270.1|3855286_3855634_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
BAB37273.2|3857955_3858489_-	PagC-like membrane protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.2e-15
BAB37278.1|3861483_3863133_+	T3SS secreted effector EspL	NA	NA	NA	NA	NA
BAB37280.1|3863740_3864730_+	T3SS secreted effector NleB	NA	Q8HAB2	Salmonella_phage	58.5	2.9e-98
BAB37281.1|3864778_3865453_+	T3SS secreted effector NleE	NA	NA	NA	NA	NA
BAB37285.2|3869501_3870389_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BAB37286.1|3870388_3870715_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BAB37288.2|3870905_3871253_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BAB37289.2|3871302_3872841_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
BAB37291.1|3873063_3873414_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
BAB37292.1|3873626_3875030_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.1	5.0e-173
3880104:3880138	attR	AGGCCGGATAAGGCGTTCACGCCGCATCCGGCAAT	NA	NA	NA	NA
>prophage 15
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	4528171	4588517	5498578	integrase,tRNA,transposase	Stx2-converting_phage(14.29%)	60	4537819:4537835	4594268:4594284
BAB37907.1|4528171_4528645_+|tRNA	tRNA Leu mC34,mU34 2'-O-methyltransferase	tRNA	NA	NA	NA	NA
BAB37908.1|4528697_4529519_-	serine acetyltransferase	NA	NA	NA	NA	NA
BAB37909.1|4529598_4530618_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
BAB37910.1|4530617_4531085_-	protein-export protein SecB	NA	NA	NA	NA	NA
BAB37911.1|4531147_4531399_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
BAB37912.1|4531540_4531972_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
BAB37913.1|4532216_4533761_+	phosphoglyceromutase	NA	NA	NA	NA	NA
BAB37914.2|4533794_4535054_+	murein hydrolase activator	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
BAB37915.2|4535057_4536017_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
BAB37916.1|4536022_4537039_-	LPS(HepIII)-glucuronic acid glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.7e-09
BAB37917.1|4537277_4538303_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
4537819:4537835	attL	AGATCGAACGACAGCGC	NA	NA	NA	NA
BAB37918.1|4538312_4539509_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
BAB37919.1|4539783_4540656_-	hypothetical protein	NA	NA	NA	NA	NA
BAB37920.1|4540944_4541877_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
BAB37921.1|4541886_4542933_+	heptosyltransferase II	NA	NA	NA	NA	NA
BAB37922.1|4542936_4543929_+	heptosyltransferase I	NA	NA	NA	NA	NA
BAB37923.1|4543925_4545134_+	O-antigen ligase	NA	NA	NA	NA	NA
BAB37924.1|4545169_4546312_-	lipopolysaccharide 1,2-N- acetylglucosamine transferase WaaD	NA	NA	NA	NA	NA
BAB37925.1|4546320_4547334_-	lipopolysaccharide 1,2-glucosyltransferase WaaR	NA	NA	NA	NA	NA
BAB37926.1|4547358_4548066_-	lipopolysaccharide core biosynthesis protein WaaY	NA	NA	NA	NA	NA
BAB37927.1|4548091_4549099_-	UDP-D-galactose:(glucosyl)lipopolysaccharide- alpha-1,3-D-galactosyltransferase	NA	NA	NA	NA	NA
BAB37928.2|4549141_4549939_-	kinase that phosphorylates core heptose of lipopolysaccharide	NA	NA	NA	NA	NA
BAB37929.1|4549931_4551056_-	glucosyltransferase I	NA	NA	NA	NA	NA
BAB37930.1|4551052_4552111_-	lipopolysaccharide core biosynthesis protein WaaQ	NA	NA	NA	NA	NA
BAB37931.1|4552523_4553801_+	3-deoxy-D-manno-octulosonic-acid transferase	NA	NA	NA	NA	NA
BAB37932.1|4553808_4554288_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
BAB37933.1|4554326_4555136_-	formamidopyrimidine/5-formyluracil/ 5-hydroxymethyluracil DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
BAB37934.1|4555233_4555401_-	50S ribosomal subunit protein L33	NA	NA	NA	NA	NA
BAB37935.1|4555421_4555658_-	50S ribosomal subunit protein L28	NA	NA	NA	NA	NA
BAB37936.2|4555874_4556543_-	hypothetical protein	NA	NA	NA	NA	NA
BAB37937.2|4556714_4557935_+	phosphopantothenoylcysteine decarboxylase	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
BAB37938.2|4557912_4558371_+	deoxyuridinetriphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
BAB37939.2|4558477_4559074_+	division inhibitor protein	NA	NA	NA	NA	NA
BAB37940.1|4559110_4559752_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
BAB37941.1|4559817_4560534_-	ribonuclease PH	NA	NA	NA	NA	NA
BAB37942.1|4560660_4561524_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37943.2|4561744_4562569_+	DNA-damage-inducible protein DinD	NA	A0A1W6JPJ7	Morganella_phage	76.1	4.5e-89
BAB37944.2|4562860_4563478_+	inner membrane protein	NA	NA	NA	NA	NA
BAB37945.2|4563474_4565157_-	DNA ligase	NA	A0A1Q2U2Q6	Vibrio_phage	23.8	3.3e-22
BAB37946.1|4565414_4566038_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	33.9	3.5e-17
BAB37947.1|4566092_4566368_+	RNA polymerase omega subunit	NA	NA	NA	NA	NA
BAB37948.1|4566386_4568495_+	bifunctional (p)ppGpp synthase/hydrolase SpoT	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
BAB37949.2|4568534_4569191_+|tRNA	tRNA mG18-2'-O-methyltransferase	tRNA	NA	NA	NA	NA
BAB37950.1|4569196_4571278_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
BAB37951.2|4571262_4572129_-	hypothetical protein	NA	NA	NA	NA	NA
BAB37952.1|4572131_4573337_-	glutamate transporter	NA	NA	NA	NA	NA
BAB37953.1|4573616_4575008_+	xanthine permease	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
BAB37954.1|4575128_4576838_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37955.1|4576890_4579209_-	alpha-glucosidase	NA	NA	NA	NA	NA
BAB37956.2|4579218_4580601_-	transporter	NA	NA	NA	NA	NA
BAB37957.1|4581183_4582365_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
BAB37958.2|4582499_4582814_+|transposase	IS602 transposase	transposase	Q716C1	Shigella_phage	59.6	3.6e-23
BAB37960.2|4582933_4583680_+|transposase	IS602 transposase	transposase	Q716C2	Shigella_phage	59.4	8.8e-84
BAB37962.1|4583930_4584305_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37963.1|4584301_4584793_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37964.1|4584804_4585002_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37965.1|4585086_4585428_+	hypothetical protein	NA	NA	NA	NA	NA
BAB37968.2|4586204_4586585_+|transposase	ISEc8 transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BAB37969.1|4586581_4586929_+|transposase	ISEc8 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BAB37970.1|4586978_4588517_+|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
4594268:4594284	attR	AGATCGAACGACAGCGC	NA	NA	NA	NA
>prophage 16
BA000007	Escherichia coli O157:H7 str. Sakai DNA, complete genome	5498578	5041219	5115987	5498578	head,plate,portal,tRNA,protease,tail	Shigella_phage(53.66%)	86	NA	NA
BAB38366.1|5041219_5041750_-	regulatory protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
BAB38367.1|5041940_5042189_+	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
BAB38368.1|5042190_5044281_+	DNA transposition protein	NA	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
BAB38369.1|5044351_5045284_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
BAB38370.1|5045286_5045508_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38371.1|5045520_5045775_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38372.1|5045776_5046058_+	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
BAB38373.1|5046054_5046327_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38374.1|5046331_5046625_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38375.1|5046636_5047167_+	host-nuclease inhibitor protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
BAB38376.1|5047264_5047807_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
BAB38377.1|5047810_5048344_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	2.8e-68
BAB38378.1|5048343_5048859_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
BAB38379.2|5048862_5049414_+	hypothetical protein	NA	NA	NA	NA	NA
BBE29474.1|5049410_5049596_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38380.2|5049634_5049967_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38381.1|5049959_5050157_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
BAB38382.1|5050146_5050443_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38383.1|5050439_5050949_+	phage regluatory protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
BAB38384.1|5051018_5051444_+	positive regulator of late transcription protein	NA	NA	NA	NA	NA
BAB38385.1|5051515_5052016_+	phage lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
BAB38386.2|5052050_5052479_+	endopeptidase	NA	NA	NA	NA	NA
BAB38388.1|5052690_5052918_+	RNA polymerase-binding transcription factor	NA	NA	NA	NA	NA
BAB38389.1|5052898_5053207_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38390.1|5053203_5053494_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
BAB38391.1|5053496_5054078_+	hypothetical protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
BAB38392.1|5054077_5055742_+	DNA packaging protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
BAB38393.2|5055741_5057331_+|portal	portal protein	portal	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
BAB38394.1|5057314_5058640_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
BAB38395.1|5058758_5059232_+	phage morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
BAB38396.1|5059408_5060533_+|protease	protease/scaffold protein	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
BAB38397.1|5060532_5061480_+|head	phage major head subunit	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
BAB38398.1|5061523_5061910_+	DNA processing protein	NA	NA	NA	NA	NA
BAB38399.1|5061906_5062326_+	hypothetical protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
BAB38400.1|5062322_5062883_+	phage structural protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
BAB38401.1|5062883_5063129_+	phage structural protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
BAB38402.1|5063125_5064628_+|tail	phage tail sheath protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
BAB38403.1|5064636_5065002_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
BAB38404.1|5065016_5065493_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
BAB38405.1|5065619_5067695_+	phage tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
BAB38406.2|5067681_5069031_+	phage DNA circulation protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
BAB38407.1|5069014_5070139_+|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
BAB38408.2|5070128_5070743_+|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
BAB38409.1|5070735_5071173_+|tail	phage tail protein	tail	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
BAB38410.2|5071172_5072255_+|tail	phage tail protein	tail	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
BAB38411.1|5072245_5072806_+|tail	phage tail protein	tail	C9DGQ7	Escherichia_phage	48.1	2.3e-44
BAB38412.1|5072805_5073717_+|tail	phage tail fiber	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
BAB38413.1|5073751_5074273_-|tail	phage tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
BAB38414.1|5074352_5074556_-|tail	tail fiber protein	tail	NA	NA	NA	NA
BAB38415.1|5074777_5075338_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
BAB38416.1|5075437_5077477_+	hypothetical protein	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
BAB38417.1|5077623_5077806_+	hypothetical protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
BAB38418.1|5077841_5078087_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38419.2|5078125_5078590_-	hypothetical protein	NA	NA	NA	NA	NA
BAB38420.1|5078704_5078905_+	transcriptional regulator	NA	NA	NA	NA	NA
BAB38421.1|5078858_5079596_+	DNA modification protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
BAB38423.1|5079927_5080725_-	sorbose-permease PTS system IIC component	NA	NA	NA	NA	NA
BAB38424.1|5080790_5081285_-	sorbose-permease PTS system IIB component	NA	NA	NA	NA	NA
BAB38425.1|5081284_5081692_-	sorbose-permease PTS system IIA component	NA	NA	NA	NA	NA
BAB38426.1|5081701_5082508_-	sorbitol-6-phosphate 2-dehydrogenase	NA	NA	NA	NA	NA
BAB38427.1|5082577_5083525_-	sor-operon regulator	NA	NA	NA	NA	NA
BAB38428.1|5083872_5084745_+	ribosomal large subunit pseudouridine synthase F	NA	NA	NA	NA	NA
BAB38429.1|5084745_5085018_-	hypothetical protein	NA	NA	NA	NA	NA
BAB38430.1|5085270_5086620_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
BAB38431.1|5087144_5088794_+	glucosephosphate isomerase	NA	NA	NA	NA	NA
BAB38432.1|5089306_5089549_+	extracellular polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
BAB38433.2|5089662_5090301_+	extracellular polysaccharide production lipoprotein	NA	NA	NA	NA	NA
BAB38434.1|5090297_5091035_+	extracellular polysaccharide export OMA protein	NA	NA	NA	NA	NA
BAB38435.1|5091034_5093131_+	O-antigen capsule production periplasmic protein	NA	NA	NA	NA	NA
BAB38436.1|5093725_5094136_+	phosphate starvation inducible protein	NA	NA	NA	NA	NA
BAB38437.1|5094179_5095655_-	D-xylose transporter	NA	NA	NA	NA	NA
BAB38440.1|5098629_5099820_-	maltose transport system	NA	NA	NA	NA	NA
BAB38441.1|5100184_5101300_+	maltose ABC transporter ATPase	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
BAB38442.1|5101371_5102712_+	outer membrane maltoporin LamB	NA	NA	NA	NA	NA
BAB38443.1|5102862_5103783_+	maltose regulon periplasmic protein	NA	NA	NA	NA	NA
BAB38444.1|5104011_5105592_+	T3SS effector-like protein EspX	NA	NA	NA	NA	NA
BAB38445.2|5105814_5106312_+	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
BAB38446.1|5106324_5107197_+	4-hydroxybenzoate-octaprenyltransferase	NA	NA	NA	NA	NA
BAB38447.2|5107351_5109775_-	glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
BAB38448.1|5109945_5110314_+	diacylglycerol kinase	NA	NA	NA	NA	NA
BAB38449.1|5110423_5111032_+	transcriptional repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
BAB38450.2|5111104_5112430_+	DNA damage inducible protein DinF	NA	NA	NA	NA	NA
BAB38451.1|5112545_5112755_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38452.2|5112796_5113312_-	transcriptional repressor	NA	NA	NA	NA	NA
BAB38453.1|5113630_5114527_+	hypothetical protein	NA	NA	NA	NA	NA
BAB38454.1|5114949_5115987_+|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
>prophage 1
AB011549	Escherichia coli O157:H7 str. Sakai plasmid pO157 DNA, complete sequence	92721	29207	37998	92721	transposase	Macacine_betaherpesvirus(66.67%)	6	NA	NA
BAA31786.1|29207_30014_+	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
BAA31787.1|30735_31626_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
BAA31789.1|32003_32249_+	Rep protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	8.7e-41
BAA31790.2|32836_34003_+	SopA protein	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
BAA31791.1|34002_34974_+	SopB protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
BAA31792.1|36273_37998_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
